Incidental Mutation 'R3411:Olfr1047'
ID267695
Institutional Source Beutler Lab
Gene Symbol Olfr1047
Ensembl Gene ENSMUSG00000075196
Gene Nameolfactory receptor 1047
SynonymsMOR188-3, GA_x6K02T2Q125-47703682-47702723
MMRRC Submission 040629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R3411 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86226567-86231401 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86228642 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 110 (S110G)
Ref Sequence ENSEMBL: ENSMUSP00000150247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099901] [ENSMUST00000216056]
Predicted Effect probably benign
Transcript: ENSMUST00000099901
AA Change: S110G

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097485
Gene: ENSMUSG00000075196
AA Change: S110G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5e-51 PFAM
Pfam:7tm_1 41 290 4.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216056
AA Change: S110G

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.1608 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,419,822 V675D possibly damaging Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Aff1 T A 5: 103,754,706 M1K probably null Het
AI429214 C T 8: 36,993,917 S73L probably benign Het
Apc C A 18: 34,269,259 probably benign Het
Apcs T C 1: 172,894,563 Y72C probably damaging Het
Arid4a T C 12: 71,061,525 probably benign Het
Armcx4 C A X: 134,691,025 Q561K probably benign Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Bank1 G A 3: 136,247,773 probably benign Het
Ccdc150 A G 1: 54,356,773 D805G probably benign Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Egfem1 C T 3: 29,583,021 T202I probably damaging Het
Fam120b T A 17: 15,431,635 probably benign Het
Frem1 T C 4: 82,963,179 T1263A possibly damaging Het
Gm6802 C A 12: 19,490,620 noncoding transcript Het
Golga2 C A 2: 32,302,942 A424E probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Hcrtr2 A G 9: 76,233,008 F333L probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Htr1b A C 9: 81,632,041 V171G probably benign Het
Kalrn G T 16: 34,212,272 D1117E probably benign Het
Kcp T C 6: 29,482,846 N1408S possibly damaging Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
Lrrc8d A T 5: 105,826,706 noncoding transcript Het
Mast2 C G 4: 116,310,910 E881Q possibly damaging Het
Mcm6 T C 1: 128,351,585 T155A probably benign Het
Mslnl T C 17: 25,744,517 F326L probably benign Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr1510 T A 14: 52,410,361 R170S possibly damaging Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Otoa A G 7: 121,122,043 Q427R probably damaging Het
Pcdhb6 A G 18: 37,335,892 E622G probably damaging Het
Pdzd8 A G 19: 59,345,413 Y59H probably damaging Het
Psmc3 A C 2: 91,055,918 D159A probably damaging Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Rpn2 C A 2: 157,290,652 A108E possibly damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Slc16a4 G A 3: 107,300,872 E233K probably benign Het
Smu1 T C 4: 40,752,008 T183A probably benign Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Styxl1 T C 5: 135,765,764 Y83C probably damaging Het
Sypl2 C T 3: 108,216,729 V166I possibly damaging Het
Tal2 A G 4: 53,785,843 N8S probably damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Usp53 T C 3: 122,949,858 probably null Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Other mutations in Olfr1047
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Olfr1047 APN 2 86228629 missense possibly damaging 0.78
IGL01470:Olfr1047 APN 2 86228284 missense probably benign 0.26
IGL02179:Olfr1047 APN 2 86228247 nonsense probably null
IGL02703:Olfr1047 APN 2 86228979 utr 5 prime probably benign
R0370:Olfr1047 UTSW 2 86228713 missense probably damaging 0.99
R1452:Olfr1047 UTSW 2 86228455 missense probably damaging 0.99
R1655:Olfr1047 UTSW 2 86228080 missense possibly damaging 0.95
R1866:Olfr1047 UTSW 2 86228728 missense probably damaging 0.99
R1970:Olfr1047 UTSW 2 86228252 missense probably damaging 1.00
R2385:Olfr1047 UTSW 2 86228473 nonsense probably null
R3730:Olfr1047 UTSW 2 86228851 missense probably benign 0.00
R4655:Olfr1047 UTSW 2 86228693 missense probably benign 0.26
R6168:Olfr1047 UTSW 2 86228594 missense probably damaging 0.99
R6190:Olfr1047 UTSW 2 86228234 missense possibly damaging 0.67
R6492:Olfr1047 UTSW 2 86228387 missense possibly damaging 0.91
R7419:Olfr1047 UTSW 2 86228213 missense probably damaging 1.00
R8074:Olfr1047 UTSW 2 86228129 missense possibly damaging 0.55
Z1088:Olfr1047 UTSW 2 86228222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGATGACATTGTAGCCACAG -3'
(R):5'- CTTGGGCATGATCATCCTCAC -3'

Sequencing Primer
(F):5'- TGACATTGTAGCCACAGAAAGAC -3'
(R):5'- TGATCATCCTCACCACAGTGG -3'
Posted On2015-02-18