Incidental Mutation 'R3411:Psmc3'
ID267696
Institutional Source Beutler Lab
Gene Symbol Psmc3
Ensembl Gene ENSMUSG00000002102
Gene Nameproteasome (prosome, macropain) 26S subunit, ATPase 3
SynonymsTat binding protein 1, TBP-1
MMRRC Submission 040629-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3411 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location91054009-91066369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 91055918 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 159 (D159A)
Ref Sequence ENSEMBL: ENSMUSP00000071054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002171] [ENSMUST00000067663] [ENSMUST00000111441] [ENSMUST00000185715]
Predicted Effect probably damaging
Transcript: ENSMUST00000002171
AA Change: D159A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002171
Gene: ENSMUSG00000002102
AA Change: D159A

DomainStartEndE-ValueType
AAA 222 361 6.65e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067663
AA Change: D159A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071054
Gene: ENSMUSG00000002102
AA Change: D159A

DomainStartEndE-ValueType
AAA 222 361 6.65e-22 SMART
Blast:AAA 390 436 9e-20 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111441
AA Change: D117A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107068
Gene: ENSMUSG00000002102
AA Change: D117A

DomainStartEndE-ValueType
AAA 180 319 6.65e-22 SMART
Blast:AAA 348 394 8e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145317
Predicted Effect unknown
Transcript: ENSMUST00000146506
AA Change: D141A
SMART Domains Protein: ENSMUSP00000121688
Gene: ENSMUSG00000002102
AA Change: D141A

DomainStartEndE-ValueType
PDB:4CR4|M 13 183 2e-69 PDB
Blast:AAA 140 183 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152269
Predicted Effect probably damaging
Transcript: ENSMUST00000185715
AA Change: D140A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139782
Gene: ENSMUSG00000002102
AA Change: D140A

DomainStartEndE-ValueType
AAA 203 301 9e-14 SMART
Meta Mutation Damage Score 0.7049 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases that have chaperone-like activity. This subunit may compete with PSMC2 for binding to the HIV tat protein to regulate the interaction between the viral protein and the transcription complex. A pseudogene has been identified on chromosome 9. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,419,822 V675D possibly damaging Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Aff1 T A 5: 103,754,706 M1K probably null Het
AI429214 C T 8: 36,993,917 S73L probably benign Het
Apc C A 18: 34,269,259 probably benign Het
Apcs T C 1: 172,894,563 Y72C probably damaging Het
Arid4a T C 12: 71,061,525 probably benign Het
Armcx4 C A X: 134,691,025 Q561K probably benign Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Bank1 G A 3: 136,247,773 probably benign Het
Ccdc150 A G 1: 54,356,773 D805G probably benign Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Egfem1 C T 3: 29,583,021 T202I probably damaging Het
Fam120b T A 17: 15,431,635 probably benign Het
Frem1 T C 4: 82,963,179 T1263A possibly damaging Het
Gm6802 C A 12: 19,490,620 noncoding transcript Het
Golga2 C A 2: 32,302,942 A424E probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Hcrtr2 A G 9: 76,233,008 F333L probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Htr1b A C 9: 81,632,041 V171G probably benign Het
Kalrn G T 16: 34,212,272 D1117E probably benign Het
Kcp T C 6: 29,482,846 N1408S possibly damaging Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
Lrrc8d A T 5: 105,826,706 noncoding transcript Het
Mast2 C G 4: 116,310,910 E881Q possibly damaging Het
Mcm6 T C 1: 128,351,585 T155A probably benign Het
Mslnl T C 17: 25,744,517 F326L probably benign Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Olfr1047 T C 2: 86,228,642 S110G probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr1510 T A 14: 52,410,361 R170S possibly damaging Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Otoa A G 7: 121,122,043 Q427R probably damaging Het
Pcdhb6 A G 18: 37,335,892 E622G probably damaging Het
Pdzd8 A G 19: 59,345,413 Y59H probably damaging Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Rpn2 C A 2: 157,290,652 A108E possibly damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Slc16a4 G A 3: 107,300,872 E233K probably benign Het
Smu1 T C 4: 40,752,008 T183A probably benign Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Styxl1 T C 5: 135,765,764 Y83C probably damaging Het
Sypl2 C T 3: 108,216,729 V166I possibly damaging Het
Tal2 A G 4: 53,785,843 N8S probably damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Usp53 T C 3: 122,949,858 probably null Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Other mutations in Psmc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
E0370:Psmc3 UTSW 2 91055118 splice site probably null
R0747:Psmc3 UTSW 2 91054300 missense probably benign 0.10
R1182:Psmc3 UTSW 2 91056035 missense probably damaging 1.00
R1763:Psmc3 UTSW 2 91055995 missense possibly damaging 0.81
R1967:Psmc3 UTSW 2 91057844 missense probably benign 0.19
R2056:Psmc3 UTSW 2 91058088 missense probably benign 0.40
R2484:Psmc3 UTSW 2 91056001 missense probably damaging 0.97
R3608:Psmc3 UTSW 2 91054580 missense probably benign 0.00
R4917:Psmc3 UTSW 2 91065972 unclassified probably benign
R4954:Psmc3 UTSW 2 91055629 intron probably benign
R5033:Psmc3 UTSW 2 91054608 missense probably benign 0.03
R5073:Psmc3 UTSW 2 91054570 splice site probably benign
R5279:Psmc3 UTSW 2 91054322 missense probably benign
R5354:Psmc3 UTSW 2 91059353 missense probably damaging 1.00
R6169:Psmc3 UTSW 2 91057839 missense probably damaging 1.00
R6224:Psmc3 UTSW 2 91054630 missense probably damaging 1.00
R7039:Psmc3 UTSW 2 91055046 missense probably benign 0.32
R7275:Psmc3 UTSW 2 91055930 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATTCTCCAGTAAGCTGCCTTG -3'
(R):5'- GCACCTGACAGTCTTTGTTTTG -3'

Sequencing Primer
(F):5'- AGTAAGCTGCCTTGCCACTG -3'
(R):5'- CACAGTAAGGGAATACACTCTGGTC -3'
Posted On2015-02-18