Incidental Mutation 'R3411:Smu1'
ID267704
Institutional Source Beutler Lab
Gene Symbol Smu1
Ensembl Gene ENSMUSG00000028409
Gene Namesmu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Synonyms2610203K23Rik, 2600001O03Rik, SMU-1
MMRRC Submission 040629-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R3411 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location40736542-40757923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40752008 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 183 (T183A)
Ref Sequence ENSEMBL: ENSMUSP00000030117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030117]
Predicted Effect probably benign
Transcript: ENSMUST00000030117
AA Change: T183A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030117
Gene: ENSMUSG00000028409
AA Change: T183A

DomainStartEndE-ValueType
LisH 6 38 9.95e-7 SMART
CTLH 40 92 2.32e-7 SMART
WD40 202 242 9.02e-7 SMART
WD40 253 292 3.81e-5 SMART
WD40 295 335 5.26e-8 SMART
WD40 338 377 4.4e-10 SMART
WD40 380 426 1.03e1 SMART
WD40 428 470 2.97e0 SMART
WD40 473 512 9.52e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150574
Meta Mutation Damage Score 0.0585 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,419,822 V675D possibly damaging Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Aff1 T A 5: 103,754,706 M1K probably null Het
AI429214 C T 8: 36,993,917 S73L probably benign Het
Apc C A 18: 34,269,259 probably benign Het
Apcs T C 1: 172,894,563 Y72C probably damaging Het
Arid4a T C 12: 71,061,525 probably benign Het
Armcx4 C A X: 134,691,025 Q561K probably benign Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Bank1 G A 3: 136,247,773 probably benign Het
Ccdc150 A G 1: 54,356,773 D805G probably benign Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Egfem1 C T 3: 29,583,021 T202I probably damaging Het
Fam120b T A 17: 15,431,635 probably benign Het
Frem1 T C 4: 82,963,179 T1263A possibly damaging Het
Gm6802 C A 12: 19,490,620 noncoding transcript Het
Golga2 C A 2: 32,302,942 A424E probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Hcrtr2 A G 9: 76,233,008 F333L probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Htr1b A C 9: 81,632,041 V171G probably benign Het
Kalrn G T 16: 34,212,272 D1117E probably benign Het
Kcp T C 6: 29,482,846 N1408S possibly damaging Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
Lrrc8d A T 5: 105,826,706 noncoding transcript Het
Mast2 C G 4: 116,310,910 E881Q possibly damaging Het
Mcm6 T C 1: 128,351,585 T155A probably benign Het
Mslnl T C 17: 25,744,517 F326L probably benign Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Olfr1047 T C 2: 86,228,642 S110G probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr1510 T A 14: 52,410,361 R170S possibly damaging Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Otoa A G 7: 121,122,043 Q427R probably damaging Het
Pcdhb6 A G 18: 37,335,892 E622G probably damaging Het
Pdzd8 A G 19: 59,345,413 Y59H probably damaging Het
Psmc3 A C 2: 91,055,918 D159A probably damaging Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Rpn2 C A 2: 157,290,652 A108E possibly damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Slc16a4 G A 3: 107,300,872 E233K probably benign Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Styxl1 T C 5: 135,765,764 Y83C probably damaging Het
Sypl2 C T 3: 108,216,729 V166I possibly damaging Het
Tal2 A G 4: 53,785,843 N8S probably damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Usp53 T C 3: 122,949,858 probably null Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Other mutations in Smu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02992:Smu1 APN 4 40739550 missense probably damaging 0.97
IGL03271:Smu1 APN 4 40738408 missense probably benign 0.11
IGL03329:Smu1 APN 4 40739568 missense possibly damaging 0.81
PIT4585001:Smu1 UTSW 4 40739623 missense probably benign
R0172:Smu1 UTSW 4 40738439 missense probably benign 0.00
R1109:Smu1 UTSW 4 40755722 missense probably benign 0.12
R1552:Smu1 UTSW 4 40748570 missense probably damaging 1.00
R1799:Smu1 UTSW 4 40745537 missense probably damaging 1.00
R2093:Smu1 UTSW 4 40738438 missense probably benign 0.12
R2143:Smu1 UTSW 4 40744073 missense probably damaging 0.99
R3082:Smu1 UTSW 4 40745567 missense probably damaging 1.00
R3083:Smu1 UTSW 4 40745567 missense probably damaging 1.00
R3113:Smu1 UTSW 4 40748658 missense probably benign 0.03
R3157:Smu1 UTSW 4 40754529 missense possibly damaging 0.82
R3158:Smu1 UTSW 4 40754529 missense possibly damaging 0.82
R3159:Smu1 UTSW 4 40754529 missense possibly damaging 0.82
R3409:Smu1 UTSW 4 40752008 missense probably benign
R4581:Smu1 UTSW 4 40737401 splice site probably null
R5106:Smu1 UTSW 4 40743104 missense possibly damaging 0.82
R7747:Smu1 UTSW 4 40748600 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGAGCTCTCGTTCCTGGAAC -3'
(R):5'- CCCACACTGAACATAGATTGTG -3'

Sequencing Primer
(F):5'- TGGAACCCAAGCTCCTAAGGTAG -3'
(R):5'- CCACACTGAACATAGATTGTGTTTGG -3'
Posted On2015-02-18