Incidental Mutation 'R3411:Kcp'
ID267711
Institutional Source Beutler Lab
Gene Symbol Kcp
Ensembl Gene ENSMUSG00000059022
Gene Namekielin/chordin-like protein
SynonymsCrim2, KCP, LOC333088
MMRRC Submission 040629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R3411 (G1)
Quality Score172
Status Validated
Chromosome6
Chromosomal Location29473162-29507952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29482846 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1408 (N1408S)
Ref Sequence ENSEMBL: ENSMUSP00000099135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078112] [ENSMUST00000091391] [ENSMUST00000101614] [ENSMUST00000159479]
Predicted Effect probably benign
Transcript: ENSMUST00000078112
SMART Domains Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 7e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1083 2.44e-8 SMART
VWC 1090 1143 1.05e-3 SMART
VWC 1150 1207 2.93e-11 SMART
Pfam:VWD 1214 1254 4.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091391
SMART Domains Protein: ENSMUSP00000088954
Gene: ENSMUSG00000059022

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 7e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1082 6.53e-9 SMART
VWC 1089 1142 1.05e-3 SMART
VWC 1149 1206 2.93e-11 SMART
Pfam:VWD 1213 1253 4.6e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101614
AA Change: N1408S

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099135
Gene: ENSMUSG00000059022
AA Change: N1408S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 8e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1083 2.44e-8 SMART
VWC 1090 1143 1.05e-3 SMART
VWC 1150 1207 2.93e-11 SMART
VWD 1201 1362 6.09e-50 SMART
C8 1404 1479 1.55e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158018
Predicted Effect probably benign
Transcript: ENSMUST00000159479
SMART Domains Protein: ENSMUSP00000124771
Gene: ENSMUSG00000059022

DomainStartEndE-ValueType
VWC 1 51 4.56e-1 SMART
VWC 54 110 1.98e-8 SMART
VWC 113 169 1.35e-1 SMART
VWC 172 228 5.77e-10 SMART
VWC 231 286 1.21e-3 SMART
VWC 289 353 6.53e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159482
Predicted Effect probably benign
Transcript: ENSMUST00000161276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161655
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Homozygous null mice display increased sensitivity to renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,419,822 V675D possibly damaging Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Aff1 T A 5: 103,754,706 M1K probably null Het
AI429214 C T 8: 36,993,917 S73L probably benign Het
Apc C A 18: 34,269,259 probably benign Het
Apcs T C 1: 172,894,563 Y72C probably damaging Het
Arid4a T C 12: 71,061,525 probably benign Het
Armcx4 C A X: 134,691,025 Q561K probably benign Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Bank1 G A 3: 136,247,773 probably benign Het
Ccdc150 A G 1: 54,356,773 D805G probably benign Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Egfem1 C T 3: 29,583,021 T202I probably damaging Het
Fam120b T A 17: 15,431,635 probably benign Het
Frem1 T C 4: 82,963,179 T1263A possibly damaging Het
Gm6802 C A 12: 19,490,620 noncoding transcript Het
Golga2 C A 2: 32,302,942 A424E probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Hcrtr2 A G 9: 76,233,008 F333L probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Htr1b A C 9: 81,632,041 V171G probably benign Het
Kalrn G T 16: 34,212,272 D1117E probably benign Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
Lrrc8d A T 5: 105,826,706 noncoding transcript Het
Mast2 C G 4: 116,310,910 E881Q possibly damaging Het
Mcm6 T C 1: 128,351,585 T155A probably benign Het
Mslnl T C 17: 25,744,517 F326L probably benign Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Olfr1047 T C 2: 86,228,642 S110G probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr1510 T A 14: 52,410,361 R170S possibly damaging Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Otoa A G 7: 121,122,043 Q427R probably damaging Het
Pcdhb6 A G 18: 37,335,892 E622G probably damaging Het
Pdzd8 A G 19: 59,345,413 Y59H probably damaging Het
Psmc3 A C 2: 91,055,918 D159A probably damaging Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Rpn2 C A 2: 157,290,652 A108E possibly damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Slc16a4 G A 3: 107,300,872 E233K probably benign Het
Smu1 T C 4: 40,752,008 T183A probably benign Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Styxl1 T C 5: 135,765,764 Y83C probably damaging Het
Sypl2 C T 3: 108,216,729 V166I possibly damaging Het
Tal2 A G 4: 53,785,843 N8S probably damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Usp53 T C 3: 122,949,858 probably null Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Other mutations in Kcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Kcp APN 6 29482657 missense probably benign
IGL01344:Kcp APN 6 29498951 splice site probably null
IGL01404:Kcp APN 6 29496639 missense probably damaging 0.99
IGL01735:Kcp APN 6 29498879 missense probably damaging 1.00
IGL01776:Kcp APN 6 29497908 missense probably damaging 1.00
IGL02092:Kcp APN 6 29489032 critical splice donor site probably null
IGL02252:Kcp APN 6 29504549 missense probably damaging 1.00
IGL02690:Kcp APN 6 29484999 unclassified probably benign
IGL02817:Kcp APN 6 29496969 missense probably damaging 0.97
IGL03074:Kcp APN 6 29496631 missense probably damaging 1.00
P0045:Kcp UTSW 6 29498348 missense probably damaging 1.00
R0219:Kcp UTSW 6 29495785 missense probably damaging 1.00
R0355:Kcp UTSW 6 29496927 missense possibly damaging 0.89
R0738:Kcp UTSW 6 29490439 missense probably benign 0.24
R1111:Kcp UTSW 6 29485423 missense probably benign
R1304:Kcp UTSW 6 29501292 unclassified probably benign
R1663:Kcp UTSW 6 29498965 missense possibly damaging 0.68
R1808:Kcp UTSW 6 29505655 missense probably benign 0.05
R1907:Kcp UTSW 6 29497835 unclassified probably benign
R2030:Kcp UTSW 6 29489072 missense probably damaging 1.00
R2099:Kcp UTSW 6 29496165 nonsense probably null
R3982:Kcp UTSW 6 29484637 missense probably damaging 1.00
R3983:Kcp UTSW 6 29484637 missense probably damaging 1.00
R4223:Kcp UTSW 6 29482258 missense possibly damaging 0.55
R4377:Kcp UTSW 6 29493203 missense probably damaging 1.00
R4570:Kcp UTSW 6 29491848 nonsense probably null
R4624:Kcp UTSW 6 29482814 missense possibly damaging 0.94
R4694:Kcp UTSW 6 29493197 missense probably benign 0.29
R4750:Kcp UTSW 6 29484626 missense probably benign 0.03
R4968:Kcp UTSW 6 29497629 nonsense probably null
R5053:Kcp UTSW 6 29496958 missense probably benign 0.01
R5067:Kcp UTSW 6 29492108 missense probably benign 0.06
R5253:Kcp UTSW 6 29498520 unclassified probably benign
R5418:Kcp UTSW 6 29504284 nonsense probably null
R6020:Kcp UTSW 6 29502864 missense probably benign 0.03
R6033:Kcp UTSW 6 29493194 missense probably damaging 1.00
R6033:Kcp UTSW 6 29493194 missense probably damaging 1.00
R6088:Kcp UTSW 6 29502632 missense probably benign
R6178:Kcp UTSW 6 29482888 missense possibly damaging 0.68
R6285:Kcp UTSW 6 29502365 missense probably benign 0.21
R6310:Kcp UTSW 6 29493258 missense probably damaging 0.98
R6369:Kcp UTSW 6 29484694 missense probably damaging 1.00
R6860:Kcp UTSW 6 29505720 missense probably benign 0.19
R6949:Kcp UTSW 6 29484612 splice site probably null
R6962:Kcp UTSW 6 29482840 missense probably benign 0.08
R7006:Kcp UTSW 6 29499170 missense probably damaging 1.00
R7138:Kcp UTSW 6 29491862 nonsense probably null
R7141:Kcp UTSW 6 29487512 nonsense probably null
R7153:Kcp UTSW 6 29499015 missense probably damaging 1.00
R7162:Kcp UTSW 6 29497200 intron probably null
R7334:Kcp UTSW 6 29485512 missense probably damaging 1.00
R7565:Kcp UTSW 6 29499187 missense probably damaging 1.00
R7671:Kcp UTSW 6 29496517 missense probably benign 0.02
R7766:Kcp UTSW 6 29496847 missense probably damaging 0.98
R7781:Kcp UTSW 6 29497765 missense probably damaging 1.00
Z1176:Kcp UTSW 6 29485012 missense probably benign 0.23
Z1177:Kcp UTSW 6 29485525 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TACCACAGAGTGTAGGACCC -3'
(R):5'- TAGTCACCTTCCCAGCTAGC -3'

Sequencing Primer
(F):5'- AGAGTGTAGGACCCCTCCAGAC -3'
(R):5'- AAACCTCTACTTTCTTTAGTGGGG -3'
Posted On2015-02-18