Incidental Mutation 'R3411:Olfr494'
ID267717
Institutional Source Beutler Lab
Gene Symbol Olfr494
Ensembl Gene ENSMUSG00000109631
Gene Nameolfactory receptor 494
SynonymsMOR204-10, GA_x6K02T2PBJ9-10697517-10698461
MMRRC Submission 040629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R3411 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108365335-108368436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108368344 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 285 (I285F)
Ref Sequence ENSEMBL: ENSMUSP00000147830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073059] [ENSMUST00000209743] [ENSMUST00000210291]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073059
AA Change: I285F

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072810
Gene: ENSMUSG00000109542
AA Change: I285F

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2e-56 PFAM
Pfam:7tm_1 44 293 2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209743
AA Change: I285F

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210291
AA Change: I285F

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1510 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,419,822 V675D possibly damaging Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Aff1 T A 5: 103,754,706 M1K probably null Het
AI429214 C T 8: 36,993,917 S73L probably benign Het
Apc C A 18: 34,269,259 probably benign Het
Apcs T C 1: 172,894,563 Y72C probably damaging Het
Arid4a T C 12: 71,061,525 probably benign Het
Armcx4 C A X: 134,691,025 Q561K probably benign Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Bank1 G A 3: 136,247,773 probably benign Het
Ccdc150 A G 1: 54,356,773 D805G probably benign Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Egfem1 C T 3: 29,583,021 T202I probably damaging Het
Fam120b T A 17: 15,431,635 probably benign Het
Frem1 T C 4: 82,963,179 T1263A possibly damaging Het
Gm6802 C A 12: 19,490,620 noncoding transcript Het
Golga2 C A 2: 32,302,942 A424E probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Hcrtr2 A G 9: 76,233,008 F333L probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Htr1b A C 9: 81,632,041 V171G probably benign Het
Kalrn G T 16: 34,212,272 D1117E probably benign Het
Kcp T C 6: 29,482,846 N1408S possibly damaging Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
Lrrc8d A T 5: 105,826,706 noncoding transcript Het
Mast2 C G 4: 116,310,910 E881Q possibly damaging Het
Mcm6 T C 1: 128,351,585 T155A probably benign Het
Mslnl T C 17: 25,744,517 F326L probably benign Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Olfr1047 T C 2: 86,228,642 S110G probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr1510 T A 14: 52,410,361 R170S possibly damaging Het
Otoa A G 7: 121,122,043 Q427R probably damaging Het
Pcdhb6 A G 18: 37,335,892 E622G probably damaging Het
Pdzd8 A G 19: 59,345,413 Y59H probably damaging Het
Psmc3 A C 2: 91,055,918 D159A probably damaging Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Rpn2 C A 2: 157,290,652 A108E possibly damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Slc16a4 G A 3: 107,300,872 E233K probably benign Het
Smu1 T C 4: 40,752,008 T183A probably benign Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Styxl1 T C 5: 135,765,764 Y83C probably damaging Het
Sypl2 C T 3: 108,216,729 V166I possibly damaging Het
Tal2 A G 4: 53,785,843 N8S probably damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Usp53 T C 3: 122,949,858 probably null Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Other mutations in Olfr494
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Olfr494 APN 7 108368318 missense probably damaging 1.00
IGL01934:Olfr494 APN 7 108368161 missense probably damaging 0.99
IGL02041:Olfr494 APN 7 108367535 missense probably damaging 1.00
IGL02253:Olfr494 APN 7 108368054 missense possibly damaging 0.80
IGL02902:Olfr494 APN 7 108368129 missense probably damaging 1.00
R0125:Olfr494 UTSW 7 108368369 missense probably damaging 0.98
R0523:Olfr494 UTSW 7 108368231 missense probably damaging 1.00
R0650:Olfr494 UTSW 7 108367789 missense probably damaging 1.00
R1268:Olfr494 UTSW 7 108367795 missense probably benign 0.06
R2036:Olfr494 UTSW 7 108367740 missense probably benign 0.00
R2162:Olfr494 UTSW 7 108367562 missense probably benign 0.08
R2278:Olfr494 UTSW 7 108368081 missense probably benign 0.01
R2368:Olfr494 UTSW 7 108368369 missense probably damaging 0.98
R3410:Olfr494 UTSW 7 108368344 missense possibly damaging 0.52
R3834:Olfr494 UTSW 7 108368072 missense probably damaging 0.98
R4322:Olfr494 UTSW 7 108368348 missense probably damaging 1.00
R4625:Olfr494 UTSW 7 108367688 missense probably damaging 0.98
R4724:Olfr494 UTSW 7 108367998 missense probably benign
R4843:Olfr494 UTSW 7 108368143 missense probably benign 0.01
R5525:Olfr494 UTSW 7 108367999 missense probably benign
R5954:Olfr494 UTSW 7 108367601 missense probably damaging 0.98
R7027:Olfr494 UTSW 7 108368350 missense probably damaging 0.98
R8041:Olfr494 UTSW 7 108367534 missense probably damaging 1.00
R8237:Olfr494 UTSW 7 108368027 missense not run
Z1177:Olfr494 UTSW 7 108368261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATCACAGTGTTTGTCATAGC -3'
(R):5'- AGTCTTATAACTTGAGATGGTGGTC -3'

Sequencing Primer
(F):5'- ACAGTGTTTGTCATAGCTGTCTC -3'
(R):5'- ATAACTTGAGATGGTGGTCATATTGG -3'
Posted On2015-02-18