Incidental Mutation 'R3411:Adgra1'
ID267719
Institutional Source Beutler Lab
Gene Symbol Adgra1
Ensembl Gene ENSMUSG00000025475
Gene Nameadhesion G protein-coupled receptor A1
SynonymsGpr123, D7Ertd680e, 2900059M17Rik
MMRRC Submission 040629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R3411 (G1)
Quality Score202
Status Validated
Chromosome7
Chromosomal Location139834174-139878088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139847703 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 62 (F62S)
Ref Sequence ENSEMBL: ENSMUSP00000026548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026548]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026548
AA Change: F62S

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026548
Gene: ENSMUSG00000025475
AA Change: F62S

DomainStartEndE-ValueType
Pfam:7tm_2 19 307 1.4e-16 PFAM
low complexity region 407 419 N/A INTRINSIC
low complexity region 423 434 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137584
Meta Mutation Damage Score 0.4471 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the adhesion family of G-protein-coupled receptors. Members of this family function in several sensory systems and regulate blood pressure, immune responses, food intake and development. A similar protein in rodents is thought to play a role in in the regulation of neuronal signaling pathways. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,419,822 V675D possibly damaging Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Aff1 T A 5: 103,754,706 M1K probably null Het
AI429214 C T 8: 36,993,917 S73L probably benign Het
Apc C A 18: 34,269,259 probably benign Het
Apcs T C 1: 172,894,563 Y72C probably damaging Het
Arid4a T C 12: 71,061,525 probably benign Het
Armcx4 C A X: 134,691,025 Q561K probably benign Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Bank1 G A 3: 136,247,773 probably benign Het
Ccdc150 A G 1: 54,356,773 D805G probably benign Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Egfem1 C T 3: 29,583,021 T202I probably damaging Het
Fam120b T A 17: 15,431,635 probably benign Het
Frem1 T C 4: 82,963,179 T1263A possibly damaging Het
Gm6802 C A 12: 19,490,620 noncoding transcript Het
Golga2 C A 2: 32,302,942 A424E probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Hcrtr2 A G 9: 76,233,008 F333L probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Htr1b A C 9: 81,632,041 V171G probably benign Het
Kalrn G T 16: 34,212,272 D1117E probably benign Het
Kcp T C 6: 29,482,846 N1408S possibly damaging Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
Lrrc8d A T 5: 105,826,706 noncoding transcript Het
Mast2 C G 4: 116,310,910 E881Q possibly damaging Het
Mcm6 T C 1: 128,351,585 T155A probably benign Het
Mslnl T C 17: 25,744,517 F326L probably benign Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Olfr1047 T C 2: 86,228,642 S110G probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr1510 T A 14: 52,410,361 R170S possibly damaging Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Otoa A G 7: 121,122,043 Q427R probably damaging Het
Pcdhb6 A G 18: 37,335,892 E622G probably damaging Het
Pdzd8 A G 19: 59,345,413 Y59H probably damaging Het
Psmc3 A C 2: 91,055,918 D159A probably damaging Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Rpn2 C A 2: 157,290,652 A108E possibly damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Slc16a4 G A 3: 107,300,872 E233K probably benign Het
Smu1 T C 4: 40,752,008 T183A probably benign Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Styxl1 T C 5: 135,765,764 Y83C probably damaging Het
Sypl2 C T 3: 108,216,729 V166I possibly damaging Het
Tal2 A G 4: 53,785,843 N8S probably damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Usp53 T C 3: 122,949,858 probably null Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Other mutations in Adgra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Adgra1 APN 7 139875944 missense probably benign 0.01
IGL01014:Adgra1 APN 7 139875660 missense probably benign 0.05
IGL01014:Adgra1 APN 7 139875661 missense probably damaging 1.00
IGL01068:Adgra1 APN 7 139845625 missense probably damaging 0.96
IGL01095:Adgra1 APN 7 139845654 missense possibly damaging 0.79
IGL02717:Adgra1 APN 7 139876178 missense probably damaging 0.98
adaga UTSW 7 139875280 missense probably damaging 1.00
I2288:Adgra1 UTSW 7 139852579 missense probably damaging 0.98
R0630:Adgra1 UTSW 7 139852584 nonsense probably null
R0653:Adgra1 UTSW 7 139876147 missense probably damaging 0.98
R1388:Adgra1 UTSW 7 139874003 missense probably damaging 0.97
R1462:Adgra1 UTSW 7 139875829 missense probably damaging 1.00
R1462:Adgra1 UTSW 7 139875829 missense probably damaging 1.00
R1667:Adgra1 UTSW 7 139845648 missense possibly damaging 0.95
R1770:Adgra1 UTSW 7 139874031 nonsense probably null
R2083:Adgra1 UTSW 7 139875631 missense probably damaging 0.99
R2967:Adgra1 UTSW 7 139875685 missense possibly damaging 0.68
R3410:Adgra1 UTSW 7 139847703 missense possibly damaging 0.94
R3687:Adgra1 UTSW 7 139852590 missense probably damaging 1.00
R3804:Adgra1 UTSW 7 139845594 missense probably benign 0.01
R3912:Adgra1 UTSW 7 139845714 critical splice donor site probably null
R4452:Adgra1 UTSW 7 139852521 missense probably benign 0.02
R4466:Adgra1 UTSW 7 139840836 intron probably benign
R4469:Adgra1 UTSW 7 139876061 missense probably damaging 0.96
R4675:Adgra1 UTSW 7 139876186 missense probably damaging 1.00
R4724:Adgra1 UTSW 7 139875589 missense probably benign
R5220:Adgra1 UTSW 7 139875596 missense probably benign 0.06
R5846:Adgra1 UTSW 7 139875280 missense probably damaging 1.00
R5972:Adgra1 UTSW 7 139845667 missense probably damaging 1.00
R6453:Adgra1 UTSW 7 139875427 missense probably benign 0.09
R7242:Adgra1 UTSW 7 139847657 critical splice acceptor site probably null
R7343:Adgra1 UTSW 7 139876142 missense probably damaging 1.00
R7774:Adgra1 UTSW 7 139847712 missense possibly damaging 0.79
V1662:Adgra1 UTSW 7 139852579 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGGTCTGCTCCTTCGGATG -3'
(R):5'- GTCACTATAGAAGCCTCAGTCTC -3'

Sequencing Primer
(F):5'- GCTCCTTCGGATGGGTTCC -3'
(R):5'- TATAGAAGCCTCAGTCTCCCCGG -3'
Posted On2015-02-18