Incidental Mutation 'R3411:Htr1b'
ID267723
Institutional Source Beutler Lab
Gene Symbol Htr1b
Ensembl Gene ENSMUSG00000049511
Gene Name5-hydroxytryptamine (serotonin) receptor 1B
Synonyms5-HT1B receptor, 5-HT<1B> receptor, 5HT1B receptor
MMRRC Submission 040629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R3411 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location81628291-81633828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 81632041 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 171 (V171G)
Ref Sequence ENSEMBL: ENSMUSP00000139389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051005] [ENSMUST00000183482]
Predicted Effect probably benign
Transcript: ENSMUST00000051005
AA Change: V171G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000050898
Gene: ENSMUSG00000049511
AA Change: V171G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 53 188 6e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 380 7.5e-12 PFAM
Pfam:7tm_1 62 365 1.8e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181893
Predicted Effect probably benign
Transcript: ENSMUST00000183482
AA Change: V171G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139389
Gene: ENSMUSG00000049511
AA Change: V171G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 53 188 5.7e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 380 7.5e-12 PFAM
Pfam:7tm_1 62 365 1e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183781
Meta Mutation Damage Score 0.4614 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene is a G-protein coupled receptor for serotonin (5-hydroxytryptamine). Ligand binding activates second messengers that inhibit the activity of adenylate cyclase and manage the release of serotonin, dopamine, and acetylcholine in the brain. The encoded protein may be involved in several neuropsychiatric disorders and therefore is often a target of antidepressant and other psychotherapeutic drugs. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit an increase in body weight, aggression, drinking behavior, and osteoblast proliferation and bone mass, and show altered spatial learning and operant conditional behavior as well as reduced anxiety-related response and startle reflex, and small testes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,419,822 V675D possibly damaging Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Aff1 T A 5: 103,754,706 M1K probably null Het
AI429214 C T 8: 36,993,917 S73L probably benign Het
Apc C A 18: 34,269,259 probably benign Het
Apcs T C 1: 172,894,563 Y72C probably damaging Het
Arid4a T C 12: 71,061,525 probably benign Het
Armcx4 C A X: 134,691,025 Q561K probably benign Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Bank1 G A 3: 136,247,773 probably benign Het
Ccdc150 A G 1: 54,356,773 D805G probably benign Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Egfem1 C T 3: 29,583,021 T202I probably damaging Het
Fam120b T A 17: 15,431,635 probably benign Het
Frem1 T C 4: 82,963,179 T1263A possibly damaging Het
Gm6802 C A 12: 19,490,620 noncoding transcript Het
Golga2 C A 2: 32,302,942 A424E probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Hcrtr2 A G 9: 76,233,008 F333L probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Kalrn G T 16: 34,212,272 D1117E probably benign Het
Kcp T C 6: 29,482,846 N1408S possibly damaging Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
Lrrc8d A T 5: 105,826,706 noncoding transcript Het
Mast2 C G 4: 116,310,910 E881Q possibly damaging Het
Mcm6 T C 1: 128,351,585 T155A probably benign Het
Mslnl T C 17: 25,744,517 F326L probably benign Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Olfr1047 T C 2: 86,228,642 S110G probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr1510 T A 14: 52,410,361 R170S possibly damaging Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Otoa A G 7: 121,122,043 Q427R probably damaging Het
Pcdhb6 A G 18: 37,335,892 E622G probably damaging Het
Pdzd8 A G 19: 59,345,413 Y59H probably damaging Het
Psmc3 A C 2: 91,055,918 D159A probably damaging Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Rpn2 C A 2: 157,290,652 A108E possibly damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Slc16a4 G A 3: 107,300,872 E233K probably benign Het
Smu1 T C 4: 40,752,008 T183A probably benign Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Styxl1 T C 5: 135,765,764 Y83C probably damaging Het
Sypl2 C T 3: 108,216,729 V166I possibly damaging Het
Tal2 A G 4: 53,785,843 N8S probably damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Usp53 T C 3: 122,949,858 probably null Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Other mutations in Htr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02932:Htr1b APN 9 81631636 missense probably damaging 1.00
IGL03144:Htr1b APN 9 81631945 missense probably damaging 0.96
IGL03350:Htr1b APN 9 81632122 missense probably damaging 1.00
R0395:Htr1b UTSW 9 81631651 missense probably benign 0.09
R0697:Htr1b UTSW 9 81631463 missense possibly damaging 0.77
R1569:Htr1b UTSW 9 81632287 missense probably benign 0.01
R3821:Htr1b UTSW 9 81632434 missense probably benign 0.02
R4359:Htr1b UTSW 9 81632351 missense probably benign 0.12
R4487:Htr1b UTSW 9 81631539 missense probably benign 0.01
R4489:Htr1b UTSW 9 81631539 missense probably benign 0.01
R4715:Htr1b UTSW 9 81631510 missense possibly damaging 0.95
R5502:Htr1b UTSW 9 81631801 missense possibly damaging 0.82
R6393:Htr1b UTSW 9 81631757 missense probably benign 0.11
R6616:Htr1b UTSW 9 81632434 missense probably benign
R6900:Htr1b UTSW 9 81631570 missense probably damaging 1.00
R7038:Htr1b UTSW 9 81632243 missense probably benign
R8074:Htr1b UTSW 9 81631529 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGTTTCAAAATCCGAGAGCG -3'
(R):5'- CATGTACACGGTCACTGGAC -3'

Sequencing Primer
(F):5'- AGCGGGCTTCCACATAGATG -3'
(R):5'- TCACTGGACGCTGGACACTAG -3'
Posted On2015-02-18