Incidental Mutation 'R3411:Olfr1510'
ID267735
Institutional Source Beutler Lab
Gene Symbol Olfr1510
Ensembl Gene ENSMUSG00000063106
Gene Nameolfactory receptor 1510
SynonymsGA_x6K02T2RJGY-583652-584608, MOR223-6
MMRRC Submission 040629-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3411 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location52409131-52414373 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52410361 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 170 (R170S)
Ref Sequence ENSEMBL: ENSMUSP00000150294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079459] [ENSMUST00000215928]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079459
AA Change: R170S

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000078424
Gene: ENSMUSG00000063106
AA Change: R170S

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 8.1e-50 PFAM
Pfam:7tm_1 45 293 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206257
AA Change: R170S
Predicted Effect possibly damaging
Transcript: ENSMUST00000215928
AA Change: R170S

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,419,822 V675D possibly damaging Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Aff1 T A 5: 103,754,706 M1K probably null Het
AI429214 C T 8: 36,993,917 S73L probably benign Het
Apc C A 18: 34,269,259 probably benign Het
Apcs T C 1: 172,894,563 Y72C probably damaging Het
Arid4a T C 12: 71,061,525 probably benign Het
Armcx4 C A X: 134,691,025 Q561K probably benign Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Bank1 G A 3: 136,247,773 probably benign Het
Ccdc150 A G 1: 54,356,773 D805G probably benign Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Egfem1 C T 3: 29,583,021 T202I probably damaging Het
Fam120b T A 17: 15,431,635 probably benign Het
Frem1 T C 4: 82,963,179 T1263A possibly damaging Het
Gm6802 C A 12: 19,490,620 noncoding transcript Het
Golga2 C A 2: 32,302,942 A424E probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Hcrtr2 A G 9: 76,233,008 F333L probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Htr1b A C 9: 81,632,041 V171G probably benign Het
Kalrn G T 16: 34,212,272 D1117E probably benign Het
Kcp T C 6: 29,482,846 N1408S possibly damaging Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
Lrrc8d A T 5: 105,826,706 noncoding transcript Het
Mast2 C G 4: 116,310,910 E881Q possibly damaging Het
Mcm6 T C 1: 128,351,585 T155A probably benign Het
Mslnl T C 17: 25,744,517 F326L probably benign Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Olfr1047 T C 2: 86,228,642 S110G probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Otoa A G 7: 121,122,043 Q427R probably damaging Het
Pcdhb6 A G 18: 37,335,892 E622G probably damaging Het
Pdzd8 A G 19: 59,345,413 Y59H probably damaging Het
Psmc3 A C 2: 91,055,918 D159A probably damaging Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Rpn2 C A 2: 157,290,652 A108E possibly damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Slc16a4 G A 3: 107,300,872 E233K probably benign Het
Smu1 T C 4: 40,752,008 T183A probably benign Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Styxl1 T C 5: 135,765,764 Y83C probably damaging Het
Sypl2 C T 3: 108,216,729 V166I possibly damaging Het
Tal2 A G 4: 53,785,843 N8S probably damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Usp53 T C 3: 122,949,858 probably null Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Other mutations in Olfr1510
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Olfr1510 APN 14 52410842 missense probably benign 0.04
IGL02097:Olfr1510 APN 14 52410054 missense probably benign
R0282:Olfr1510 UTSW 14 52410263 missense possibly damaging 0.94
R1449:Olfr1510 UTSW 14 52410567 missense probably damaging 1.00
R2113:Olfr1510 UTSW 14 52410296 missense probably damaging 1.00
R2870:Olfr1510 UTSW 14 52410861 missense probably benign
R2870:Olfr1510 UTSW 14 52410861 missense probably benign
R2872:Olfr1510 UTSW 14 52410861 missense probably benign
R2872:Olfr1510 UTSW 14 52410861 missense probably benign
R2873:Olfr1510 UTSW 14 52410861 missense probably benign
R3409:Olfr1510 UTSW 14 52410361 missense possibly damaging 0.64
R4480:Olfr1510 UTSW 14 52410308 missense probably damaging 1.00
R5292:Olfr1510 UTSW 14 52410445 missense possibly damaging 0.90
R5297:Olfr1510 UTSW 14 52410218 missense probably damaging 1.00
R5441:Olfr1510 UTSW 14 52409957 missense probably benign 0.02
R5749:Olfr1510 UTSW 14 52410504 missense probably damaging 1.00
R5872:Olfr1510 UTSW 14 52410768 missense probably damaging 1.00
R5941:Olfr1510 UTSW 14 52410068 missense probably benign 0.01
R7209:Olfr1510 UTSW 14 52410093 missense possibly damaging 0.80
R7379:Olfr1510 UTSW 14 52410261 missense probably benign 0.08
R7463:Olfr1510 UTSW 14 52410711 missense probably benign 0.00
R7692:Olfr1510 UTSW 14 52410488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGGCATGAACTATGTTGGC -3'
(R):5'- GCAAGGCTATCCCATTTGGTG -3'

Sequencing Primer
(F):5'- CTATGTTGGCATAGGAGAGCAGAATC -3'
(R):5'- GGTGGTTGTGCAGCTCAAC -3'
Posted On2015-02-18