Incidental Mutation 'R3411:Armcx4'
ID267746
Institutional Source Beutler Lab
Gene Symbol Armcx4
Ensembl Gene ENSMUSG00000049804
Gene Namearmadillo repeat containing, X-linked 4
Synonyms
MMRRC Submission 040629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R3411 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location134686519-134696757 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 134691025 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 561 (Q561K)
Ref Sequence ENSEMBL: ENSMUSP00000132914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124226]
Predicted Effect probably benign
Transcript: ENSMUST00000124226
AA Change: Q561K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132914
Gene: ENSMUSG00000049804
AA Change: Q561K

DomainStartEndE-ValueType
low complexity region 75 85 N/A INTRINSIC
low complexity region 107 121 N/A INTRINSIC
low complexity region 155 166 N/A INTRINSIC
internal_repeat_3 167 357 5.37e-6 PROSPERO
internal_repeat_1 211 401 2.32e-9 PROSPERO
internal_repeat_2 277 414 9.67e-8 PROSPERO
low complexity region 416 437 N/A INTRINSIC
low complexity region 501 525 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
internal_repeat_2 560 697 9.67e-8 PROSPERO
internal_repeat_1 574 764 2.32e-9 PROSPERO
internal_repeat_3 616 790 5.37e-6 PROSPERO
low complexity region 792 805 N/A INTRINSIC
low complexity region 828 838 N/A INTRINSIC
low complexity region 1217 1234 N/A INTRINSIC
low complexity region 1465 1482 N/A INTRINSIC
low complexity region 1620 1637 N/A INTRINSIC
low complexity region 1680 1736 N/A INTRINSIC
low complexity region 1754 1770 N/A INTRINSIC
low complexity region 1792 1829 N/A INTRINSIC
low complexity region 1850 1871 N/A INTRINSIC
low complexity region 1946 1959 N/A INTRINSIC
Pfam:Arm_2 2094 2350 2.6e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154072
Meta Mutation Damage Score 0.0815 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the armadillo repeat-containing family of proteins, which interact with other proteins in a variety of cellular processes. The function of this family member is currently unknown. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,419,822 V675D possibly damaging Het
Adamts16 T C 13: 70,753,226 T911A probably benign Het
Adgra1 T C 7: 139,847,703 F62S possibly damaging Het
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
Aff1 T A 5: 103,754,706 M1K probably null Het
AI429214 C T 8: 36,993,917 S73L probably benign Het
Apc C A 18: 34,269,259 probably benign Het
Apcs T C 1: 172,894,563 Y72C probably damaging Het
Arid4a T C 12: 71,061,525 probably benign Het
Atp5o C T 16: 91,928,906 R64H probably damaging Het
Bank1 G A 3: 136,247,773 probably benign Het
Ccdc150 A G 1: 54,356,773 D805G probably benign Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Dnah1 A T 14: 31,269,817 M3076K possibly damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Egfem1 C T 3: 29,583,021 T202I probably damaging Het
Fam120b T A 17: 15,431,635 probably benign Het
Frem1 T C 4: 82,963,179 T1263A possibly damaging Het
Gm6802 C A 12: 19,490,620 noncoding transcript Het
Golga2 C A 2: 32,302,942 A424E probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Grik5 T C 7: 25,062,972 D198G probably benign Het
Hcrtr2 A G 9: 76,233,008 F333L probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Htr1b A C 9: 81,632,041 V171G probably benign Het
Kalrn G T 16: 34,212,272 D1117E probably benign Het
Kcp T C 6: 29,482,846 N1408S possibly damaging Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Klra17 T A 6: 129,874,846 N21I probably damaging Het
Lrrc8d A T 5: 105,826,706 noncoding transcript Het
Mast2 C G 4: 116,310,910 E881Q possibly damaging Het
Mcm6 T C 1: 128,351,585 T155A probably benign Het
Mslnl T C 17: 25,744,517 F326L probably benign Het
Nlrp4c A G 7: 6,092,570 K816E possibly damaging Het
Olfr1047 T C 2: 86,228,642 S110G probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr1510 T A 14: 52,410,361 R170S possibly damaging Het
Olfr494 A T 7: 108,368,344 I285F possibly damaging Het
Otoa A G 7: 121,122,043 Q427R probably damaging Het
Pcdhb6 A G 18: 37,335,892 E622G probably damaging Het
Pdzd8 A G 19: 59,345,413 Y59H probably damaging Het
Psmc3 A C 2: 91,055,918 D159A probably damaging Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Rpn2 C A 2: 157,290,652 A108E possibly damaging Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Slc16a4 G A 3: 107,300,872 E233K probably benign Het
Smu1 T C 4: 40,752,008 T183A probably benign Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Styxl1 T C 5: 135,765,764 Y83C probably damaging Het
Sypl2 C T 3: 108,216,729 V166I possibly damaging Het
Tal2 A G 4: 53,785,843 N8S probably damaging Het
Tenm4 T C 7: 96,852,530 Y1314H probably damaging Het
Ttn A C 2: 76,942,405 N2415K possibly damaging Het
Usp53 T C 3: 122,949,858 probably null Het
Vmn2r65 T C 7: 84,946,688 I263V probably benign Het
Other mutations in Armcx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02366:Armcx4 APN X 134691512 missense possibly damaging 0.72
R0627:Armcx4 UTSW X 134695823 missense possibly damaging 0.71
R2507:Armcx4 UTSW X 134695379 missense possibly damaging 0.86
X0013:Armcx4 UTSW X 134694307 missense possibly damaging 0.53
Z1176:Armcx4 UTSW X 134693042 missense not run
Z1176:Armcx4 UTSW X 134694091 missense possibly damaging 0.53
Z1177:Armcx4 UTSW X 134693042 missense not run
Predicted Primers PCR Primer
(F):5'- CACGTCTAAGGAAGGAGCTCAG -3'
(R):5'- GCCTTATTCTTGGCTCCAGGTG -3'

Sequencing Primer
(F):5'- GCCAGGGTGAAGCCTTACCTAATAC -3'
(R):5'- TGTGGTCTCACCCTGGGAAC -3'
Posted On2015-02-18