Incidental Mutation 'R3412:Pla2g4f'
ID267751
Institutional Source Beutler Lab
Gene Symbol Pla2g4f
Ensembl Gene ENSMUSG00000046971
Gene Namephospholipase A2, group IVF
Synonyms4732472I07Rik, Pla2zeta
MMRRC Submission 040630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3412 (G1)
Quality Score188
Status Validated
Chromosome2
Chromosomal Location120299957-120314165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120303106 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 579 (S579G)
Ref Sequence ENSEMBL: ENSMUSP00000062607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054651]
Predicted Effect probably benign
Transcript: ENSMUST00000054651
AA Change: S579G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062607
Gene: ENSMUSG00000046971
AA Change: S579G

DomainStartEndE-ValueType
C2 45 144 7.51e-11 SMART
PLAc 285 797 1.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142183
Meta Mutation Damage Score 0.0934 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Arhgef5 A G 6: 43,273,790 I492V probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Ccdc162 T C 10: 41,539,549 probably benign Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Esp24 T A 17: 39,038,316 I11N possibly damaging Het
Exoc4 A G 6: 33,265,975 E41G probably damaging Het
Eya1 T A 1: 14,274,209 probably null Het
Gckr T A 5: 31,300,867 probably null Het
Gm4981 G A 10: 58,236,353 T13I possibly damaging Het
Gria4 T A 9: 4,513,278 D277V probably benign Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Krt90 T A 15: 101,560,593 L171F probably damaging Het
Mthfd1 A G 12: 76,303,749 probably null Het
Olfr262 T C 19: 12,241,590 I24V probably benign Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr786 A T 10: 129,437,307 D165V probably damaging Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc12a5 A G 2: 164,968,431 D10G probably benign Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Sos1 T C 17: 80,406,717 D1108G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Tacc2 A G 7: 130,734,994 T2369A probably benign Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubr5 T C 15: 38,004,235 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Pla2g4f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Pla2g4f APN 2 120302738 missense possibly damaging 0.53
IGL01652:Pla2g4f APN 2 120302235 missense possibly damaging 0.86
IGL02792:Pla2g4f APN 2 120303369 missense probably damaging 1.00
R0625:Pla2g4f UTSW 2 120305041 missense probably damaging 1.00
R1760:Pla2g4f UTSW 2 120314066 unclassified probably benign
R1799:Pla2g4f UTSW 2 120311068 missense possibly damaging 0.49
R2212:Pla2g4f UTSW 2 120303106 missense probably benign
R2351:Pla2g4f UTSW 2 120300442 missense probably benign 0.01
R3414:Pla2g4f UTSW 2 120303106 missense probably benign
R3906:Pla2g4f UTSW 2 120300499 missense probably benign 0.28
R4084:Pla2g4f UTSW 2 120312325 missense probably benign 0.36
R4477:Pla2g4f UTSW 2 120303672 missense probably damaging 1.00
R4529:Pla2g4f UTSW 2 120300619 missense probably damaging 0.99
R4606:Pla2g4f UTSW 2 120313986 missense probably benign 0.00
R4685:Pla2g4f UTSW 2 120305015 missense probably damaging 1.00
R4728:Pla2g4f UTSW 2 120300921 missense probably benign 0.19
R4782:Pla2g4f UTSW 2 120303276 missense probably damaging 1.00
R4957:Pla2g4f UTSW 2 120300499 missense probably benign 0.28
R5781:Pla2g4f UTSW 2 120305023 missense probably damaging 0.97
R6158:Pla2g4f UTSW 2 120301071 missense probably benign 0.21
R6232:Pla2g4f UTSW 2 120302221 missense possibly damaging 0.63
R6629:Pla2g4f UTSW 2 120308242 missense probably damaging 1.00
R6894:Pla2g4f UTSW 2 120303596 missense probably benign 0.44
R6939:Pla2g4f UTSW 2 120307301 missense probably damaging 1.00
R7131:Pla2g4f UTSW 2 120304554 missense probably null 0.01
R7221:Pla2g4f UTSW 2 120300995 missense probably benign 0.06
R7421:Pla2g4f UTSW 2 120307256 missense probably benign 0.07
R7767:Pla2g4f UTSW 2 120305009 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GGTCCTGCTTCCGTAACTTTGG -3'
(R):5'- AATTCTTCATGGGCCGGCTG -3'

Sequencing Primer
(F):5'- AACTTTGGCCAGTCATCTAGG -3'
(R):5'- TGCATTTCTGGCCAGAGC -3'
Posted On2015-02-18