Incidental Mutation 'R3412:Trim69'
ID267752
Institutional Source Beutler Lab
Gene Symbol Trim69
Ensembl Gene ENSMUSG00000033368
Gene Nametripartite motif-containing 69
Synonyms4921519C19Rik, Rnf36, Trif
MMRRC Submission 040630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R3412 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location122160700-122179027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122178644 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 395 (V395A)
Ref Sequence ENSEMBL: ENSMUSP00000047627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028665] [ENSMUST00000036089]
Predicted Effect probably benign
Transcript: ENSMUST00000028665
SMART Domains Protein: ENSMUSP00000028665
Gene: ENSMUSG00000027233

DomainStartEndE-ValueType
low complexity region 33 41 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:PAT1 247 490 6.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036089
AA Change: V395A

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000047627
Gene: ENSMUSG00000033368
AA Change: V395A

DomainStartEndE-ValueType
RING 42 82 8.48e-8 SMART
low complexity region 95 111 N/A INTRINSIC
PDB:4NQJ|C 144 322 2e-86 PDB
PRY 323 375 9.37e-19 SMART
SPRY 376 500 4.97e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143088
Meta Mutation Damage Score 0.3152 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING-B-box-coiled-coil (RBCC) family and encodes a protein with an N-terminal RING finger motif, a PRY domain and a C-terminal SPRY domain. The mouse ortholog of this gene is specifically expressed in germ cells at the round spermatid stages during spermatogenesis and, when overexpressed, induces apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Arhgef5 A G 6: 43,273,790 I492V probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Ccdc162 T C 10: 41,539,549 probably benign Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Esp24 T A 17: 39,038,316 I11N possibly damaging Het
Exoc4 A G 6: 33,265,975 E41G probably damaging Het
Eya1 T A 1: 14,274,209 probably null Het
Gckr T A 5: 31,300,867 probably null Het
Gm4981 G A 10: 58,236,353 T13I possibly damaging Het
Gria4 T A 9: 4,513,278 D277V probably benign Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Krt90 T A 15: 101,560,593 L171F probably damaging Het
Mthfd1 A G 12: 76,303,749 probably null Het
Olfr262 T C 19: 12,241,590 I24V probably benign Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr786 A T 10: 129,437,307 D165V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc12a5 A G 2: 164,968,431 D10G probably benign Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Sos1 T C 17: 80,406,717 D1108G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Tacc2 A G 7: 130,734,994 T2369A probably benign Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubr5 T C 15: 38,004,235 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Trim69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Trim69 APN 2 122167714 missense probably benign 0.00
IGL01321:Trim69 APN 2 122173284 missense possibly damaging 0.84
IGL01478:Trim69 APN 2 122178443 missense probably damaging 0.98
IGL01907:Trim69 APN 2 122167661 missense probably benign 0.00
IGL01925:Trim69 APN 2 122167916 missense probably damaging 1.00
IGL03065:Trim69 APN 2 122178634 missense probably damaging 0.98
IGL03121:Trim69 APN 2 122167647 missense probably benign 0.22
IGL03206:Trim69 APN 2 122173155 missense probably benign 0.00
R0019:Trim69 UTSW 2 122174477 splice site probably null
R0019:Trim69 UTSW 2 122174477 splice site probably null
R1956:Trim69 UTSW 2 122174475 critical splice donor site probably null
R1960:Trim69 UTSW 2 122167684 missense probably benign 0.00
R2212:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3414:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3900:Trim69 UTSW 2 122178841 missense probably benign 0.03
R4470:Trim69 UTSW 2 122178599 missense probably damaging 1.00
R4950:Trim69 UTSW 2 122178746 missense probably damaging 1.00
R5045:Trim69 UTSW 2 122174246 missense probably benign 0.08
R5237:Trim69 UTSW 2 122173340 missense probably benign
R5931:Trim69 UTSW 2 122178594 missense probably damaging 0.98
R6483:Trim69 UTSW 2 122167600 nonsense probably null
R6872:Trim69 UTSW 2 122167910 missense probably damaging 1.00
R7372:Trim69 UTSW 2 122178583 missense possibly damaging 0.94
R7451:Trim69 UTSW 2 122168027 missense probably benign 0.19
R7591:Trim69 UTSW 2 122167973 missense probably benign 0.17
R8353:Trim69 UTSW 2 122168009 missense possibly damaging 0.73
R8551:Trim69 UTSW 2 122173329 missense probably benign 0.00
Z1176:Trim69 UTSW 2 122167554 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AACAGCTCATCCCAATCTGGTG -3'
(R):5'- AAAGATGGGTCATGGTTGTAGC -3'

Sequencing Primer
(F):5'- CTGGTGTTATCCAAAAGCCAG -3'
(R):5'- GTTGTAGCGTTGTAGAAGGATAC -3'
Posted On2015-02-18