Incidental Mutation 'R3412:Atp8b4'
ID267753
Institutional Source Beutler Lab
Gene Symbol Atp8b4
Ensembl Gene ENSMUSG00000060131
Gene NameATPase, class I, type 8B, member 4
SynonymsIm
MMRRC Submission 040630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3412 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location126320973-126500674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 126375757 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 613 (W613L)
Ref Sequence ENSEMBL: ENSMUSP00000047302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040128] [ENSMUST00000040149] [ENSMUST00000147517]
Predicted Effect probably damaging
Transcript: ENSMUST00000040128
AA Change: W613L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046444
Gene: ENSMUSG00000060131
AA Change: W613L

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 3.4e-30 PFAM
Pfam:E1-E2_ATPase 81 352 5.1e-8 PFAM
Pfam:HAD 390 826 1.1e-18 PFAM
Pfam:Cation_ATPase 474 573 5.5e-10 PFAM
Pfam:PhoLip_ATPase_C 843 1097 1.6e-83 PFAM
low complexity region 1113 1130 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000040149
AA Change: W613L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047302
Gene: ENSMUSG00000060131
AA Change: W613L

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 3.4e-30 PFAM
Pfam:E1-E2_ATPase 81 352 5.1e-8 PFAM
Pfam:HAD 390 826 1.1e-18 PFAM
Pfam:Cation_ATPase 474 573 5.5e-10 PFAM
Pfam:PhoLip_ATPase_C 843 1097 1.6e-83 PFAM
low complexity region 1113 1130 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134977
Predicted Effect probably benign
Transcript: ENSMUST00000147517
SMART Domains Protein: ENSMUSP00000114252
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Blast:CUB 32 67 2e-7 BLAST
Pfam:E1-E2_ATPase 84 355 1.9e-17 PFAM
Meta Mutation Damage Score 0.8021 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cation transport ATPase (P-type) family and type IV subfamily. The encoded protein is involved in phospholipid transport in the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Arhgef5 A G 6: 43,273,790 I492V probably benign Het
Ccdc162 T C 10: 41,539,549 probably benign Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Esp24 T A 17: 39,038,316 I11N possibly damaging Het
Exoc4 A G 6: 33,265,975 E41G probably damaging Het
Eya1 T A 1: 14,274,209 probably null Het
Gckr T A 5: 31,300,867 probably null Het
Gm4981 G A 10: 58,236,353 T13I possibly damaging Het
Gria4 T A 9: 4,513,278 D277V probably benign Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Krt90 T A 15: 101,560,593 L171F probably damaging Het
Mthfd1 A G 12: 76,303,749 probably null Het
Olfr262 T C 19: 12,241,590 I24V probably benign Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr786 A T 10: 129,437,307 D165V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc12a5 A G 2: 164,968,431 D10G probably benign Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Sos1 T C 17: 80,406,717 D1108G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Tacc2 A G 7: 130,734,994 T2369A probably benign Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubr5 T C 15: 38,004,235 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Atp8b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Atp8b4 APN 2 126358897 missense probably damaging 1.00
IGL00841:Atp8b4 APN 2 126383769 missense probably damaging 0.97
IGL00917:Atp8b4 APN 2 126374533 missense probably benign 0.00
IGL01013:Atp8b4 APN 2 126323087 missense probably benign 0.25
IGL01374:Atp8b4 APN 2 126383657 splice site probably benign
IGL01898:Atp8b4 APN 2 126389361 missense probably benign 0.00
IGL01927:Atp8b4 APN 2 126322976 missense probably damaging 0.99
IGL01971:Atp8b4 APN 2 126462616 missense probably benign 0.05
R0320:Atp8b4 UTSW 2 126459694 missense possibly damaging 0.55
R0441:Atp8b4 UTSW 2 126378706 splice site probably benign
R0526:Atp8b4 UTSW 2 126427363 missense probably damaging 1.00
R0765:Atp8b4 UTSW 2 126372150 splice site probably null
R0964:Atp8b4 UTSW 2 126337493 missense probably damaging 1.00
R1386:Atp8b4 UTSW 2 126378744 missense probably benign 0.00
R1401:Atp8b4 UTSW 2 126323093 critical splice acceptor site probably null
R1568:Atp8b4 UTSW 2 126325394 missense probably benign
R1792:Atp8b4 UTSW 2 126325294 missense probably benign
R1830:Atp8b4 UTSW 2 126403381 missense probably benign 0.03
R1839:Atp8b4 UTSW 2 126361782 missense possibly damaging 0.92
R1984:Atp8b4 UTSW 2 126323008 missense probably damaging 1.00
R2143:Atp8b4 UTSW 2 126374510 missense probably damaging 1.00
R2186:Atp8b4 UTSW 2 126358860 missense probably damaging 1.00
R2212:Atp8b4 UTSW 2 126375757 missense probably damaging 1.00
R2473:Atp8b4 UTSW 2 126358894 missense possibly damaging 0.67
R3414:Atp8b4 UTSW 2 126375757 missense probably damaging 1.00
R4519:Atp8b4 UTSW 2 126414459 splice site probably null
R4543:Atp8b4 UTSW 2 126358066 missense probably damaging 0.97
R4701:Atp8b4 UTSW 2 126414293 missense probably damaging 1.00
R4818:Atp8b4 UTSW 2 126322816 missense probably benign 0.01
R4895:Atp8b4 UTSW 2 126414369 missense probably benign 0.23
R5213:Atp8b4 UTSW 2 126389409 splice site probably null
R5239:Atp8b4 UTSW 2 126392861 splice site probably null
R5241:Atp8b4 UTSW 2 126383726 missense probably benign
R5654:Atp8b4 UTSW 2 126375805 missense probably damaging 1.00
R5725:Atp8b4 UTSW 2 126433936 missense probably benign
R5771:Atp8b4 UTSW 2 126378744 missense probably benign 0.11
R5949:Atp8b4 UTSW 2 126405322 missense probably benign 0.02
R5993:Atp8b4 UTSW 2 126403234 missense probably benign
R5998:Atp8b4 UTSW 2 126433867 splice site probably null
R6550:Atp8b4 UTSW 2 126424193 missense probably damaging 1.00
R6575:Atp8b4 UTSW 2 126414364 missense probably damaging 1.00
R6892:Atp8b4 UTSW 2 126343002 missense possibly damaging 0.94
R6915:Atp8b4 UTSW 2 126358914 nonsense probably null
R7045:Atp8b4 UTSW 2 126372195 missense probably benign 0.00
R7206:Atp8b4 UTSW 2 126458292 missense probably damaging 0.99
R7349:Atp8b4 UTSW 2 126325345 missense probably benign 0.00
R7395:Atp8b4 UTSW 2 126375694 missense possibly damaging 0.76
R7429:Atp8b4 UTSW 2 126403371 missense possibly damaging 0.47
R7430:Atp8b4 UTSW 2 126403371 missense possibly damaging 0.47
R7548:Atp8b4 UTSW 2 126389342 missense probably benign
R7724:Atp8b4 UTSW 2 126322893 missense possibly damaging 0.87
Z1176:Atp8b4 UTSW 2 126414429 missense possibly damaging 0.62
Z1177:Atp8b4 UTSW 2 126322824 missense probably benign 0.06
Z1177:Atp8b4 UTSW 2 126433943 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATTGAAAGAGAACCATGTGC -3'
(R):5'- CCATGTCTGAGGAGGTACAGAG -3'

Sequencing Primer
(F):5'- GAACCATGTGCTATGTGTAAGATG -3'
(R):5'- GAGCCATGACAGCTATGTAATACTC -3'
Posted On2015-02-18