Mutagenetix > Incidental Mutations

Incidental Mutation 'R3412:Slc12a5'

267754

Institutional Source

Beutler Lab

Gene Symbol

Slc12a5

Ensembl Gene

ENSMUSG00000017740

Gene Name

solute carrier family 12, member 5

Synonyms

KCC2

MMRRC Submission

040630-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3412 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

164960802-164999731 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 164968431 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 10 (D10G)

Ref Sequence

ENSEMBL: ENSMUSP00000144540 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099092] [ENSMUST00000202136] [ENSMUST00000202223] [ENSMUST00000202479] [ENSMUST00000202623]

Predicted Effect

probably benign
Transcript: ENSMUST00000099092
AA Change: D10G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000096690
Gene: ENSMUSG00000017740
AA Change: D10G

Domain	Start	End	E-Value	Type
low complexity region	10	22	N/A	INTRINSIC
low complexity region	77	90	N/A	INTRINSIC
Pfam:AA_permease	102	304	5.2e-22	PFAM
Pfam:AA_permease_2	364	632	1e-17	PFAM
Pfam:AA_permease	389	676	1.9e-42	PFAM
Pfam:SLC12	688	814	2.1e-19	PFAM
Pfam:SLC12	807	959	1.8e-20	PFAM
low complexity region	978	1002	N/A	INTRINSIC
Pfam:SLC12	1009	1115	2.1e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124372

Predicted Effect

probably benign
Transcript: ENSMUST00000202136
AA Change: D10G

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000143973
Gene: ENSMUSG00000017740
AA Change: D10G

Domain	Start	End	E-Value	Type
low complexity region	10	22	N/A	INTRINSIC
low complexity region	77	90	N/A	INTRINSIC
Pfam:AA_permease	102	175	2.5e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000202223

SMART Domains

Protein: ENSMUSP00000143870
Gene: ENSMUSG00000017740

Domain	Start	End	E-Value	Type
low complexity region	11	19	N/A	INTRINSIC
low complexity region	100	113	N/A	INTRINSIC
Pfam:AA_permease	125	327	1e-19	PFAM
Pfam:AA_permease_2	386	655	4.5e-15	PFAM
Pfam:AA_permease	412	699	3.7e-40	PFAM
Pfam:SLC12	711	837	7.2e-17	PFAM
Pfam:SLC12	830	982	6.2e-18	PFAM
low complexity region	1001	1025	N/A	INTRINSIC
Pfam:SLC12	1030	1133	8.6e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000202479
AA Change: D10G

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000144540
Gene: ENSMUSG00000017740
AA Change: D10G

Domain	Start	End	E-Value	Type
low complexity region	10	22	N/A	INTRINSIC
low complexity region	77	90	N/A	INTRINSIC
Pfam:AA_permease	102	176	5.2e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000202623

SMART Domains

Protein: ENSMUSP00000144623
Gene: ENSMUSG00000017740

Domain	Start	End	E-Value	Type
low complexity region	11	19	N/A	INTRINSIC
low complexity region	100	113	N/A	INTRINSIC
Pfam:AA_permease	125	327	5.3e-22	PFAM
Pfam:AA_permease_2	386	655	1.2e-17	PFAM
Pfam:AA_permease	412	699	2e-42	PFAM
Pfam:SLC12	711	837	2.1e-19	PFAM
Pfam:SLC12	830	982	1.8e-20	PFAM
low complexity region	1001	1025	N/A	INTRINSIC
Pfam:SLC12	1032	1138	2.2e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208579

Meta Mutation Damage Score

0.0608

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] K-Cl cotransporters are proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The protein encoded by this gene is an integral membrane K-Cl cotransporter that can function in either a net efflux or influx pathway, depending on the chemical concentration gradients of potassium and chloride. The encoded protein can act as a homomultimer, or as a heteromultimer with other K-Cl cotransporters, to maintain chloride homeostasis in neurons. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within a few minutes of birth of respiratory failure resulting from a motor nerve defect. Mice homozygous for a hypomorphic allele display postnatal lethality and tonic-clonic seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adarb2	T	C	13: 8,752,618	F643S	probably damaging	Het
Ap2a2	T	A	7: 141,598,776	N105K	probably benign	Het
Arhgef5	A	G	6: 43,273,790	I492V	probably benign	Het
Atp8b4	C	A	2: 126,375,757	W613L	probably damaging	Het
Ccdc162	T	C	10: 41,539,549		probably benign	Het
Diexf	A	C	1: 193,128,502	S64R	possibly damaging	Het
Esp24	T	A	17: 39,038,316	I11N	possibly damaging	Het
Exoc4	A	G	6: 33,265,975	E41G	probably damaging	Het
Eya1	T	A	1: 14,274,209		probably null	Het
Gckr	T	A	5: 31,300,867		probably null	Het
Gm4981	G	A	10: 58,236,353	T13I	possibly damaging	Het
Gria4	T	A	9: 4,513,278	D277V	probably benign	Het
Il18r1	A	T	1: 40,491,067	D318V	probably damaging	Het
Il4i1	T	C	7: 44,836,658	L22P	probably damaging	Het
Inpp5d	C	A	1: 87,668,057	T175N	possibly damaging	Het
Krt90	T	A	15: 101,560,593	L171F	probably damaging	Het
Mthfd1	A	G	12: 76,303,749		probably null	Het
Olfr262	T	C	19: 12,241,590	I24V	probably benign	Het
Olfr561	T	C	7: 102,774,755	L77P	possibly damaging	Het
Olfr635	T	C	7: 103,979,402	L76P	probably damaging	Het
Olfr786	A	T	10: 129,437,307	D165V	probably damaging	Het
Pla2g4f	T	C	2: 120,303,106	S579G	probably benign	Het
Ppef2	T	G	5: 92,228,722	S649R	probably damaging	Het
Prss43	G	C	9: 110,829,464	Q277H	probably damaging	Het
Ramp2	TTGCTGCTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTG	11: 101,246,545		probably benign	Het
Rusc2	T	G	4: 43,415,935	S414A	probably damaging	Het
Sez6l	A	G	5: 112,475,361	L108P	possibly damaging	Het
Slc1a7	A	G	4: 108,010,994	E497G	probably benign	Het
Sos1	T	C	17: 80,406,717	D1108G	probably benign	Het
Spag8	T	A	4: 43,651,606	S423C	probably damaging	Het
Tacc2	A	G	7: 130,734,994	T2369A	probably benign	Het
Taok2	T	C	7: 126,870,858	I933V	possibly damaging	Het
Tex9	C	A	9: 72,477,758	Q265H	possibly damaging	Het
Trim69	T	C	2: 122,178,644	V395A	probably benign	Het
Tusc1	C	A	4: 93,334,936	R162L	probably damaging	Het
Ubr5	T	C	15: 38,004,235		probably benign	Het
Zfyve28	C	T	5: 34,199,684	M723I	probably benign	Het
Zmynd8	A	T	2: 165,815,451	M533K	probably damaging	Het

Other mutations in Slc12a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Slc12a5	APN	2	164997121	missense	probably damaging	1.00
IGL00425:Slc12a5	APN	2	164983281	missense	probably damaging	1.00
IGL00976:Slc12a5	APN	2	164979304	missense	probably damaging	1.00
IGL01654:Slc12a5	APN	2	164973755	missense	possibly damaging	0.91
IGL01905:Slc12a5	APN	2	164990381	missense	probably benign	0.02
IGL02205:Slc12a5	APN	2	164996479	missense	probably benign	0.03
IGL02510:Slc12a5	APN	2	164982808	splice site	probably benign
IGL02746:Slc12a5	APN	2	164974916	missense	probably benign	0.01
R0051:Slc12a5	UTSW	2	164986663	missense	probably damaging	1.00
R0254:Slc12a5	UTSW	2	164997245	critical splice donor site	probably null
R0412:Slc12a5	UTSW	2	164994062	missense	probably benign	0.05
R0587:Slc12a5	UTSW	2	164976533	missense	probably damaging	1.00
R0835:Slc12a5	UTSW	2	164994038	missense	probably damaging	0.97
R0932:Slc12a5	UTSW	2	164996885	splice site	probably benign
R1643:Slc12a5	UTSW	2	164994027	missense	probably benign	0.01
R1700:Slc12a5	UTSW	2	164992376	missense	possibly damaging	0.94
R1760:Slc12a5	UTSW	2	164996128	missense	probably damaging	0.99
R2063:Slc12a5	UTSW	2	164997147	missense	probably damaging	1.00
R2293:Slc12a5	UTSW	2	164992330	missense	probably benign	0.03
R2412:Slc12a5	UTSW	2	164976462	critical splice donor site	probably null
R3035:Slc12a5	UTSW	2	164980258	missense	probably benign	0.06
R3116:Slc12a5	UTSW	2	164996181	splice site	probably null
R3788:Slc12a5	UTSW	2	164993775	missense	probably damaging	1.00
R4039:Slc12a5	UTSW	2	164992330	missense	probably benign	0.03
R4174:Slc12a5	UTSW	2	164979490	missense	probably damaging	1.00
R4492:Slc12a5	UTSW	2	164979343	missense	probably benign	0.08
R4608:Slc12a5	UTSW	2	164973765	missense	probably damaging	0.99
R4750:Slc12a5	UTSW	2	164982931	missense	probably benign	0.06
R4994:Slc12a5	UTSW	2	164983365	splice site	probably null
R5103:Slc12a5	UTSW	2	164992433	missense	probably damaging	1.00
R5539:Slc12a5	UTSW	2	164987206	missense	possibly damaging	0.94
R5632:Slc12a5	UTSW	2	164987221	missense	possibly damaging	0.86
R5771:Slc12a5	UTSW	2	164973768	missense	possibly damaging	0.88
R6139:Slc12a5	UTSW	2	164992311	missense	probably damaging	0.98
R6336:Slc12a5	UTSW	2	164992464	splice site	probably null
R6581:Slc12a5	UTSW	2	164987115	missense	probably damaging	1.00
R6706:Slc12a5	UTSW	2	164988589	missense	probably damaging	1.00
R6886:Slc12a5	UTSW	2	164982905	missense	probably benign
R7134:Slc12a5	UTSW	2	164974958	missense	probably damaging	1.00
R7310:Slc12a5	UTSW	2	164992440	missense	probably damaging	1.00
R7402:Slc12a5	UTSW	2	164982932	missense	probably benign	0.01
R8079:Slc12a5	UTSW	2	164992452	missense	probably damaging	1.00
R8301:Slc12a5	UTSW	2	164993691	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCTGCATACGGGATGAGGTG -3'
(R):5'- ATTCCAATGGAGCTAGCCTC -3'

Sequencing Primer
(F):5'- AGCGCCGCTACTGAGAG -3'
(R):5'- AGCTAGCCTCCCTGCAG -3'

Posted On

2015-02-18