Incidental Mutation 'R3412:Slc1a7'
ID267758
Institutional Source Beutler Lab
Gene Symbol Slc1a7
Ensembl Gene ENSMUSG00000008932
Gene Namesolute carrier family 1 (glutamate transporter), member 7
SynonymsEAAT5
MMRRC Submission 040630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3412 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location107968332-108013532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108010994 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 497 (E497G)
Ref Sequence ENSEMBL: ENSMUSP00000102324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044248] [ENSMUST00000106708] [ENSMUST00000106709] [ENSMUST00000106713] [ENSMUST00000146851]
Predicted Effect probably benign
Transcript: ENSMUST00000044248
SMART Domains Protein: ENSMUSP00000048962
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106708
SMART Domains Protein: ENSMUSP00000102319
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106709
SMART Domains Protein: ENSMUSP00000102320
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106713
AA Change: E497G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000102324
Gene: ENSMUSG00000008932
AA Change: E497G

DomainStartEndE-ValueType
Pfam:SDF 29 485 1.9e-127 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145491
Predicted Effect probably benign
Transcript: ENSMUST00000146851
SMART Domains Protein: ENSMUSP00000121478
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
LRR 1 24 1.19e1 SMART
LRR 47 71 2.84e1 SMART
LRR 94 116 6.22e0 SMART
LRR 117 142 3.47e0 SMART
LRR_TYP 143 166 7.9e-4 SMART
LRR 188 213 1.26e1 SMART
LRR 214 237 2.82e0 SMART
LRR 262 284 1.53e2 SMART
LRR_TYP 285 308 7.37e-4 SMART
low complexity region 319 334 N/A INTRINSIC
low complexity region 359 364 N/A INTRINSIC
Meta Mutation Damage Score 0.0758 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Arhgef5 A G 6: 43,273,790 I492V probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Ccdc162 T C 10: 41,539,549 probably benign Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Esp24 T A 17: 39,038,316 I11N possibly damaging Het
Exoc4 A G 6: 33,265,975 E41G probably damaging Het
Eya1 T A 1: 14,274,209 probably null Het
Gckr T A 5: 31,300,867 probably null Het
Gm4981 G A 10: 58,236,353 T13I possibly damaging Het
Gria4 T A 9: 4,513,278 D277V probably benign Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Krt90 T A 15: 101,560,593 L171F probably damaging Het
Mthfd1 A G 12: 76,303,749 probably null Het
Olfr262 T C 19: 12,241,590 I24V probably benign Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr786 A T 10: 129,437,307 D165V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc12a5 A G 2: 164,968,431 D10G probably benign Het
Sos1 T C 17: 80,406,717 D1108G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Tacc2 A G 7: 130,734,994 T2369A probably benign Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubr5 T C 15: 38,004,235 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Slc1a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Slc1a7 APN 4 107992965 missense probably damaging 1.00
IGL02643:Slc1a7 APN 4 108012300 missense possibly damaging 0.86
IGL03146:Slc1a7 APN 4 107992992 missense probably damaging 0.98
R1023:Slc1a7 UTSW 4 108007573 missense probably damaging 1.00
R1629:Slc1a7 UTSW 4 108008143 missense probably damaging 1.00
R1869:Slc1a7 UTSW 4 108008364 missense probably damaging 1.00
R1957:Slc1a7 UTSW 4 107968585 missense probably benign 0.05
R1970:Slc1a7 UTSW 4 107968585 missense probably benign 0.05
R1971:Slc1a7 UTSW 4 107968585 missense probably benign 0.05
R2058:Slc1a7 UTSW 4 108004439 missense probably benign 0.41
R2201:Slc1a7 UTSW 4 107993006 missense probably damaging 1.00
R2212:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3413:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3414:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3734:Slc1a7 UTSW 4 107977644 missense probably damaging 1.00
R4109:Slc1a7 UTSW 4 107968661 missense probably benign 0.22
R4662:Slc1a7 UTSW 4 108007554 missense probably damaging 1.00
R4676:Slc1a7 UTSW 4 107977674 missense possibly damaging 0.95
R4801:Slc1a7 UTSW 4 107993040 missense probably damaging 1.00
R4802:Slc1a7 UTSW 4 107993040 missense probably damaging 1.00
R4935:Slc1a7 UTSW 4 108007561 missense probably damaging 1.00
R5896:Slc1a7 UTSW 4 108012390 missense probably benign 0.02
R5947:Slc1a7 UTSW 4 108010300 unclassified probably benign
R6056:Slc1a7 UTSW 4 108012261 missense probably benign 0.00
R6088:Slc1a7 UTSW 4 108012444 missense probably damaging 1.00
R6134:Slc1a7 UTSW 4 108012436 missense probably damaging 1.00
R6141:Slc1a7 UTSW 4 108002182 missense possibly damaging 0.50
R7378:Slc1a7 UTSW 4 108002203 missense possibly damaging 0.50
R7587:Slc1a7 UTSW 4 108010486 missense possibly damaging 0.93
R8002:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8003:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8022:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8023:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTGAGTGTGGCTCTCTACC -3'
(R):5'- GAACATCTGGACCTCTGCAG -3'

Sequencing Primer
(F):5'- GAGTGTGGCTCTCTACCAGTTC -3'
(R):5'- TTGTGGTGACCCCCAACCATAG -3'
Posted On2015-02-18