Mutagenetix > Incidental Mutations

Incidental Mutation 'R3412:Zfyve28'

267760

Institutional Source

Beutler Lab

Gene Symbol

Zfyve28

Ensembl Gene

ENSMUSG00000037224

Gene Name

zinc finger, FYVE domain containing 28

Synonyms

9630058O20Rik

MMRRC Submission

040630-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3412 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34194893-34288449 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 34199684 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 723 (M723I)

Ref Sequence

ENSEMBL: ENSMUSP00000092464 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094868]

Predicted Effect

probably benign
Transcript: ENSMUST00000094868
AA Change: M723I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000092464
Gene: ENSMUSG00000037224
AA Change: M723I

Domain	Start	End	E-Value	Type
low complexity region	718	730	N/A	INTRINSIC
FYVE	827	896	8.73e-25	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (40/41)

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adarb2	T	C	13: 8,752,618	F643S	probably damaging	Het
Ap2a2	T	A	7: 141,598,776	N105K	probably benign	Het
Arhgef5	A	G	6: 43,273,790	I492V	probably benign	Het
Atp8b4	C	A	2: 126,375,757	W613L	probably damaging	Het
Ccdc162	T	C	10: 41,539,549		probably benign	Het
Diexf	A	C	1: 193,128,502	S64R	possibly damaging	Het
Esp24	T	A	17: 39,038,316	I11N	possibly damaging	Het
Exoc4	A	G	6: 33,265,975	E41G	probably damaging	Het
Eya1	T	A	1: 14,274,209		probably null	Het
Gckr	T	A	5: 31,300,867		probably null	Het
Gm4981	G	A	10: 58,236,353	T13I	possibly damaging	Het
Gria4	T	A	9: 4,513,278	D277V	probably benign	Het
Il18r1	A	T	1: 40,491,067	D318V	probably damaging	Het
Il4i1	T	C	7: 44,836,658	L22P	probably damaging	Het
Inpp5d	C	A	1: 87,668,057	T175N	possibly damaging	Het
Krt90	T	A	15: 101,560,593	L171F	probably damaging	Het
Mthfd1	A	G	12: 76,303,749		probably null	Het
Olfr262	T	C	19: 12,241,590	I24V	probably benign	Het
Olfr561	T	C	7: 102,774,755	L77P	possibly damaging	Het
Olfr635	T	C	7: 103,979,402	L76P	probably damaging	Het
Olfr786	A	T	10: 129,437,307	D165V	probably damaging	Het
Pla2g4f	T	C	2: 120,303,106	S579G	probably benign	Het
Ppef2	T	G	5: 92,228,722	S649R	probably damaging	Het
Prss43	G	C	9: 110,829,464	Q277H	probably damaging	Het
Ramp2	TTGCTGCTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTG	11: 101,246,545		probably benign	Het
Rusc2	T	G	4: 43,415,935	S414A	probably damaging	Het
Sez6l	A	G	5: 112,475,361	L108P	possibly damaging	Het
Slc12a5	A	G	2: 164,968,431	D10G	probably benign	Het
Slc1a7	A	G	4: 108,010,994	E497G	probably benign	Het
Sos1	T	C	17: 80,406,717	D1108G	probably benign	Het
Spag8	T	A	4: 43,651,606	S423C	probably damaging	Het
Tacc2	A	G	7: 130,734,994	T2369A	probably benign	Het
Taok2	T	C	7: 126,870,858	I933V	possibly damaging	Het
Tex9	C	A	9: 72,477,758	Q265H	possibly damaging	Het
Trim69	T	C	2: 122,178,644	V395A	probably benign	Het
Tusc1	C	A	4: 93,334,936	R162L	probably damaging	Het
Ubr5	T	C	15: 38,004,235		probably benign	Het
Zmynd8	A	T	2: 165,815,451	M533K	probably damaging	Het

Other mutations in Zfyve28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Zfyve28	APN	5	34243195	missense	probably damaging	0.98
IGL02201:Zfyve28	APN	5	34243205	missense	probably damaging	1.00
PIT4418001:Zfyve28	UTSW	5	34233377	missense	probably damaging	1.00
R0499:Zfyve28	UTSW	5	34232206	missense	possibly damaging	0.65
R1226:Zfyve28	UTSW	5	34217064	missense	probably benign	0.00
R1290:Zfyve28	UTSW	5	34198801	missense	probably benign	0.00
R1351:Zfyve28	UTSW	5	34232205	missense	probably damaging	1.00
R1418:Zfyve28	UTSW	5	34217246	missense	probably damaging	0.99
R2062:Zfyve28	UTSW	5	34234337	missense	probably null	0.73
R2212:Zfyve28	UTSW	5	34199684	missense	probably benign	0.02
R2443:Zfyve28	UTSW	5	34216894	missense	possibly damaging	0.64
R2851:Zfyve28	UTSW	5	34196662	missense	probably damaging	1.00
R2852:Zfyve28	UTSW	5	34196662	missense	probably damaging	1.00
R3413:Zfyve28	UTSW	5	34199684	missense	probably benign	0.02
R3694:Zfyve28	UTSW	5	34217468	missense	probably damaging	1.00
R4645:Zfyve28	UTSW	5	34222443	intron	probably benign
R4700:Zfyve28	UTSW	5	34217845	missense	probably damaging	1.00
R4938:Zfyve28	UTSW	5	34233354	missense	probably damaging	0.99
R5384:Zfyve28	UTSW	5	34216967	missense	probably damaging	1.00
R5908:Zfyve28	UTSW	5	34216870	missense	possibly damaging	0.62
R5936:Zfyve28	UTSW	5	34224988	missense	probably damaging	1.00
R6260:Zfyve28	UTSW	5	34198872	missense	probably damaging	0.99
R6862:Zfyve28	UTSW	5	34288105	missense	probably benign	0.10
R7172:Zfyve28	UTSW	5	34234409	missense	probably benign	0.42
R7243:Zfyve28	UTSW	5	34198875	missense	probably damaging	1.00
R7366:Zfyve28	UTSW	5	34232227	missense	probably damaging	1.00
R7598:Zfyve28	UTSW	5	34236117	missense	probably damaging	1.00
R7654:Zfyve28	UTSW	5	34243195	missense	probably damaging	1.00
R7752:Zfyve28	UTSW	5	34224982	missense	probably damaging	1.00
R7861:Zfyve28	UTSW	5	34217143	missense	probably damaging	1.00
R7878:Zfyve28	UTSW	5	34199655	missense	probably damaging	1.00
R7901:Zfyve28	UTSW	5	34224982	missense	probably damaging	1.00
R8116:Zfyve28	UTSW	5	34217600	missense	probably damaging	0.96
R8483:Zfyve28	UTSW	5	34236136	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- TCCACTTCAGCCAGAGAAAG -3'
(R):5'- AACTTGTGGACCGACTTGC -3'

Sequencing Primer
(F):5'- CTAGATCACGCACCTGAA -3'
(R):5'- CCAAACCTAGCCTAGATGTTTGGG -3'

Posted On

2015-02-18