Incidental Mutation 'R3412:Zfyve28'
ID267760
Institutional Source Beutler Lab
Gene Symbol Zfyve28
Ensembl Gene ENSMUSG00000037224
Gene Namezinc finger, FYVE domain containing 28
Synonyms9630058O20Rik
MMRRC Submission 040630-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3412 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location34194893-34288449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34199684 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 723 (M723I)
Ref Sequence ENSEMBL: ENSMUSP00000092464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094868]
Predicted Effect probably benign
Transcript: ENSMUST00000094868
AA Change: M723I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000092464
Gene: ENSMUSG00000037224
AA Change: M723I

DomainStartEndE-ValueType
low complexity region 718 730 N/A INTRINSIC
FYVE 827 896 8.73e-25 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Arhgef5 A G 6: 43,273,790 I492V probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Ccdc162 T C 10: 41,539,549 probably benign Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Esp24 T A 17: 39,038,316 I11N possibly damaging Het
Exoc4 A G 6: 33,265,975 E41G probably damaging Het
Eya1 T A 1: 14,274,209 probably null Het
Gckr T A 5: 31,300,867 probably null Het
Gm4981 G A 10: 58,236,353 T13I possibly damaging Het
Gria4 T A 9: 4,513,278 D277V probably benign Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Krt90 T A 15: 101,560,593 L171F probably damaging Het
Mthfd1 A G 12: 76,303,749 probably null Het
Olfr262 T C 19: 12,241,590 I24V probably benign Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr786 A T 10: 129,437,307 D165V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc12a5 A G 2: 164,968,431 D10G probably benign Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Sos1 T C 17: 80,406,717 D1108G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Tacc2 A G 7: 130,734,994 T2369A probably benign Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubr5 T C 15: 38,004,235 probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Zfyve28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Zfyve28 APN 5 34243195 missense probably damaging 0.98
IGL02201:Zfyve28 APN 5 34243205 missense probably damaging 1.00
PIT4418001:Zfyve28 UTSW 5 34233377 missense probably damaging 1.00
R0499:Zfyve28 UTSW 5 34232206 missense possibly damaging 0.65
R1226:Zfyve28 UTSW 5 34217064 missense probably benign 0.00
R1290:Zfyve28 UTSW 5 34198801 missense probably benign 0.00
R1351:Zfyve28 UTSW 5 34232205 missense probably damaging 1.00
R1418:Zfyve28 UTSW 5 34217246 missense probably damaging 0.99
R2062:Zfyve28 UTSW 5 34234337 missense probably null 0.73
R2212:Zfyve28 UTSW 5 34199684 missense probably benign 0.02
R2443:Zfyve28 UTSW 5 34216894 missense possibly damaging 0.64
R2851:Zfyve28 UTSW 5 34196662 missense probably damaging 1.00
R2852:Zfyve28 UTSW 5 34196662 missense probably damaging 1.00
R3413:Zfyve28 UTSW 5 34199684 missense probably benign 0.02
R3694:Zfyve28 UTSW 5 34217468 missense probably damaging 1.00
R4645:Zfyve28 UTSW 5 34222443 intron probably benign
R4700:Zfyve28 UTSW 5 34217845 missense probably damaging 1.00
R4938:Zfyve28 UTSW 5 34233354 missense probably damaging 0.99
R5384:Zfyve28 UTSW 5 34216967 missense probably damaging 1.00
R5908:Zfyve28 UTSW 5 34216870 missense possibly damaging 0.62
R5936:Zfyve28 UTSW 5 34224988 missense probably damaging 1.00
R6260:Zfyve28 UTSW 5 34198872 missense probably damaging 0.99
R6862:Zfyve28 UTSW 5 34288105 missense probably benign 0.10
R7172:Zfyve28 UTSW 5 34234409 missense probably benign 0.42
R7243:Zfyve28 UTSW 5 34198875 missense probably damaging 1.00
R7366:Zfyve28 UTSW 5 34232227 missense probably damaging 1.00
R7598:Zfyve28 UTSW 5 34236117 missense probably damaging 1.00
R7654:Zfyve28 UTSW 5 34243195 missense probably damaging 1.00
R7752:Zfyve28 UTSW 5 34224982 missense probably damaging 1.00
R7861:Zfyve28 UTSW 5 34217143 missense probably damaging 1.00
R7878:Zfyve28 UTSW 5 34199655 missense probably damaging 1.00
R7901:Zfyve28 UTSW 5 34224982 missense probably damaging 1.00
R7944:Zfyve28 UTSW 5 34217143 missense probably damaging 1.00
R7961:Zfyve28 UTSW 5 34199655 missense probably damaging 1.00
R7984:Zfyve28 UTSW 5 34224982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACTTCAGCCAGAGAAAG -3'
(R):5'- AACTTGTGGACCGACTTGC -3'

Sequencing Primer
(F):5'- CTAGATCACGCACCTGAA -3'
(R):5'- CCAAACCTAGCCTAGATGTTTGGG -3'
Posted On2015-02-18