Incidental Mutation 'R3412:Olfr561'
ID267766
Institutional Source Beutler Lab
Gene Symbol Olfr561
Ensembl Gene ENSMUSG00000073966
Gene Nameolfactory receptor 561
SynonymsMOR14-2, GA_x6K02T2PBJ9-5491151-5492095
MMRRC Submission 040630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3412 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102771221-102776857 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102774755 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 77 (L77P)
Ref Sequence ENSEMBL: ENSMUSP00000150963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098217] [ENSMUST00000213432]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098217
AA Change: L77P

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095819
Gene: ENSMUSG00000073966
AA Change: L77P

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 5.1e-122 PFAM
Pfam:7TM_GPCR_Srsx 37 259 9.6e-8 PFAM
Pfam:7tm_1 43 294 4.4e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213432
AA Change: L77P

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Arhgef5 A G 6: 43,273,790 I492V probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Ccdc162 T C 10: 41,539,549 probably benign Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Esp24 T A 17: 39,038,316 I11N possibly damaging Het
Exoc4 A G 6: 33,265,975 E41G probably damaging Het
Eya1 T A 1: 14,274,209 probably null Het
Gckr T A 5: 31,300,867 probably null Het
Gm4981 G A 10: 58,236,353 T13I possibly damaging Het
Gria4 T A 9: 4,513,278 D277V probably benign Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Krt90 T A 15: 101,560,593 L171F probably damaging Het
Mthfd1 A G 12: 76,303,749 probably null Het
Olfr262 T C 19: 12,241,590 I24V probably benign Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr786 A T 10: 129,437,307 D165V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc12a5 A G 2: 164,968,431 D10G probably benign Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Sos1 T C 17: 80,406,717 D1108G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Tacc2 A G 7: 130,734,994 T2369A probably benign Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubr5 T C 15: 38,004,235 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Olfr561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Olfr561 APN 7 102774907 missense probably damaging 0.99
IGL02743:Olfr561 APN 7 102775298 missense probably damaging 0.99
IGL03001:Olfr561 APN 7 102775253 missense probably damaging 0.98
R0254:Olfr561 UTSW 7 102774869 nonsense probably null
R0356:Olfr561 UTSW 7 102775079 missense probably damaging 1.00
R0514:Olfr561 UTSW 7 102775332 missense probably benign 0.00
R0725:Olfr561 UTSW 7 102774532 missense probably benign
R0739:Olfr561 UTSW 7 102774665 missense probably damaging 1.00
R1900:Olfr561 UTSW 7 102775331 missense probably benign 0.19
R2080:Olfr561 UTSW 7 102775243 missense probably benign 0.02
R2212:Olfr561 UTSW 7 102774755 missense possibly damaging 0.77
R2379:Olfr561 UTSW 7 102774845 missense probably benign 0.33
R3834:Olfr561 UTSW 7 102775286 missense probably damaging 1.00
R4117:Olfr561 UTSW 7 102774477 splice site probably null
R4363:Olfr561 UTSW 7 102775256 missense probably benign 0.34
R4401:Olfr561 UTSW 7 102774799 nonsense probably null
R5176:Olfr561 UTSW 7 102775306 missense probably damaging 0.99
R5464:Olfr561 UTSW 7 102775433 missense probably benign 0.00
R5465:Olfr561 UTSW 7 102775433 missense probably benign 0.00
R5493:Olfr561 UTSW 7 102775108 missense probably benign 0.00
R5540:Olfr561 UTSW 7 102774929 missense probably benign 0.02
R5629:Olfr561 UTSW 7 102774640 missense possibly damaging 0.63
R6227:Olfr561 UTSW 7 102774676 missense probably damaging 0.98
R6367:Olfr561 UTSW 7 102774829 missense possibly damaging 0.92
R6497:Olfr561 UTSW 7 102775450 missense probably benign 0.00
R7219:Olfr561 UTSW 7 102781706 missense probably benign 0.00
R7243:Olfr561 UTSW 7 102781658 missense probably benign
R7289:Olfr561 UTSW 7 102775427 missense probably damaging 1.00
R7560:Olfr561 UTSW 7 102781682 missense probably damaging 1.00
R7731:Olfr561 UTSW 7 102774934 missense probably benign 0.05
R8025:Olfr561 UTSW 7 102775256 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- ATGCCATCCTTCAACGAGAG -3'
(R):5'- ACCTCAGTGGGTTACAGATGG -3'

Sequencing Primer
(F):5'- ACTGGCATTCCTGGTCTTGAGAC -3'
(R):5'- GGTTACAGATGGCAATAAATCGATC -3'
Posted On2015-02-18