Incidental Mutation 'R3412:Tex9'
ID267773
Institutional Source Beutler Lab
Gene Symbol Tex9
Ensembl Gene ENSMUSG00000090626
Gene Nametestis expressed gene 9
Synonymstsec-1
MMRRC Submission 040630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R3412 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location72450394-72492212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 72477758 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 265 (Q265H)
Ref Sequence ENSEMBL: ENSMUSP00000139212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085358] [ENSMUST00000183574] [ENSMUST00000183856] [ENSMUST00000184125] [ENSMUST00000184312] [ENSMUST00000184557] [ENSMUST00000184831] [ENSMUST00000185151]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085358
AA Change: Q66H

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000082467
Gene: ENSMUSG00000090626
AA Change: Q66H

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 344 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183399
Predicted Effect probably benign
Transcript: ENSMUST00000183428
Predicted Effect probably benign
Transcript: ENSMUST00000183501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183551
Predicted Effect probably benign
Transcript: ENSMUST00000183574
SMART Domains Protein: ENSMUSP00000139386
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 208 N/A INTRINSIC
coiled coil region 231 286 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183856
AA Change: Q265H

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139247
Gene: ENSMUSG00000090626
AA Change: Q265H

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 328 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184066
Predicted Effect possibly damaging
Transcript: ENSMUST00000184125
AA Change: Q265H

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139026
Gene: ENSMUSG00000090626
AA Change: Q265H

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184312
SMART Domains Protein: ENSMUSP00000138844
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000184557
AA Change: Q265H

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139212
Gene: ENSMUSG00000090626
AA Change: Q265H

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 280 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184734
Predicted Effect probably benign
Transcript: ENSMUST00000184831
AA Change: Q80H

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138999
Gene: ENSMUSG00000090626
AA Change: Q80H

DomainStartEndE-ValueType
coiled coil region 1 159 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185106
Predicted Effect probably benign
Transcript: ENSMUST00000185151
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Arhgef5 A G 6: 43,273,790 I492V probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Ccdc162 T C 10: 41,539,549 probably benign Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Esp24 T A 17: 39,038,316 I11N possibly damaging Het
Exoc4 A G 6: 33,265,975 E41G probably damaging Het
Eya1 T A 1: 14,274,209 probably null Het
Gckr T A 5: 31,300,867 probably null Het
Gm4981 G A 10: 58,236,353 T13I possibly damaging Het
Gria4 T A 9: 4,513,278 D277V probably benign Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Krt90 T A 15: 101,560,593 L171F probably damaging Het
Mthfd1 A G 12: 76,303,749 probably null Het
Olfr262 T C 19: 12,241,590 I24V probably benign Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr786 A T 10: 129,437,307 D165V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc12a5 A G 2: 164,968,431 D10G probably benign Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Sos1 T C 17: 80,406,717 D1108G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Tacc2 A G 7: 130,734,994 T2369A probably benign Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubr5 T C 15: 38,004,235 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Tex9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Tex9 APN 9 72477835 missense probably benign 0.32
IGL01109:Tex9 APN 9 72488067 missense probably damaging 1.00
IGL01373:Tex9 APN 9 72480754 missense possibly damaging 0.78
IGL02496:Tex9 APN 9 72482492 missense probably benign 0.25
IGL02569:Tex9 APN 9 72478363 missense probably damaging 1.00
barbacoa UTSW 9 72486778 critical splice donor site probably null
R0068:Tex9 UTSW 9 72486769 splice site probably benign
R0481:Tex9 UTSW 9 72478396 nonsense probably null
R0628:Tex9 UTSW 9 72491951 start codon destroyed probably null 0.99
R0962:Tex9 UTSW 9 72484092 missense probably benign
R2212:Tex9 UTSW 9 72477758 missense possibly damaging 0.89
R4373:Tex9 UTSW 9 72480595 critical splice donor site probably null
R4972:Tex9 UTSW 9 72478338 critical splice donor site probably null
R5323:Tex9 UTSW 9 72477905 missense probably damaging 1.00
R5401:Tex9 UTSW 9 72486778 critical splice donor site probably null
R6149:Tex9 UTSW 9 72462000 utr 3 prime probably null
R7396:Tex9 UTSW 9 72480790 splice site probably null
R7412:Tex9 UTSW 9 72486778 critical splice donor site probably null
X0024:Tex9 UTSW 9 72480674 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCAACCCCAGCGACTGTG -3'
(R):5'- CCAAGACCATCTGAGGCTCTTG -3'

Sequencing Primer
(F):5'- ACGGACTGAACTGCGTACTTTAC -3'
(R):5'- AAGACCATCTGAGGCTCTTGTTTTC -3'
Posted On2015-02-18