Incidental Mutation 'R3412:Prss43'
ID267774
Institutional Source Beutler Lab
Gene Symbol Prss43
Ensembl Gene ENSMUSG00000058398
Gene Nameprotease, serine 43
SynonymsLOC272643, Tessp3
MMRRC Submission 040630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3412 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location110826690-110831839 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 110829464 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 277 (Q277H)
Ref Sequence ENSEMBL: ENSMUSP00000076752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077549] [ENSMUST00000141089]
Predicted Effect probably damaging
Transcript: ENSMUST00000077549
AA Change: Q277H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076752
Gene: ENSMUSG00000058398
AA Change: Q277H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 41 49 N/A INTRINSIC
Tryp_SPc 115 350 5.86e-58 SMART
transmembrane domain 362 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141089
SMART Domains Protein: ENSMUSP00000117039
Gene: ENSMUSG00000032493

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Trypsin 112 144 1.3e-9 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Arhgef5 A G 6: 43,273,790 I492V probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Ccdc162 T C 10: 41,539,549 probably benign Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Esp24 T A 17: 39,038,316 I11N possibly damaging Het
Exoc4 A G 6: 33,265,975 E41G probably damaging Het
Eya1 T A 1: 14,274,209 probably null Het
Gckr T A 5: 31,300,867 probably null Het
Gm4981 G A 10: 58,236,353 T13I possibly damaging Het
Gria4 T A 9: 4,513,278 D277V probably benign Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Krt90 T A 15: 101,560,593 L171F probably damaging Het
Mthfd1 A G 12: 76,303,749 probably null Het
Olfr262 T C 19: 12,241,590 I24V probably benign Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr786 A T 10: 129,437,307 D165V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc12a5 A G 2: 164,968,431 D10G probably benign Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Sos1 T C 17: 80,406,717 D1108G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Tacc2 A G 7: 130,734,994 T2369A probably benign Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubr5 T C 15: 38,004,235 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Prss43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Prss43 APN 9 110829470 missense probably benign 0.02
IGL01636:Prss43 APN 9 110827437 missense possibly damaging 0.75
IGL03046:Prss43 UTSW 9 110830981 missense probably benign 0.01
PIT4576001:Prss43 UTSW 9 110827887 missense probably damaging 1.00
R0020:Prss43 UTSW 9 110828512 unclassified probably benign
R0278:Prss43 UTSW 9 110827362 missense probably benign 0.07
R0883:Prss43 UTSW 9 110829508 missense probably damaging 1.00
R1384:Prss43 UTSW 9 110827442 missense probably benign 0.10
R2212:Prss43 UTSW 9 110829464 missense probably damaging 1.00
R3808:Prss43 UTSW 9 110827772 missense probably damaging 1.00
R4202:Prss43 UTSW 9 110827461 missense probably benign 0.08
R4530:Prss43 UTSW 9 110829504 missense probably benign 0.38
R4752:Prss43 UTSW 9 110827768 missense possibly damaging 0.47
R5009:Prss43 UTSW 9 110827421 missense possibly damaging 0.50
R6920:Prss43 UTSW 9 110828612 missense probably benign 0.04
R7271:Prss43 UTSW 9 110828603 missense probably damaging 1.00
R7406:Prss43 UTSW 9 110828696 missense probably damaging 1.00
R7758:Prss43 UTSW 9 110829391 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGTATTCACACAGTCCGCGG -3'
(R):5'- AGAGTGCAGCCTACACAGAG -3'

Sequencing Primer
(F):5'- ACAGTCCGCGGCAGCTG -3'
(R):5'- CTACATAGTGAGTTCCAGGGCTAC -3'
Posted On2015-02-18