Incidental Mutation 'R3412:Gm4981'
ID267776
Institutional Source Beutler Lab
Gene Symbol Gm4981
Ensembl Gene ENSMUSG00000075045
Gene Namepredicted gene 4981
Synonyms
MMRRC Submission 040630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R3412 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location58234848-58236701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58236353 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 13 (T13I)
Ref Sequence ENSEMBL: ENSMUSP00000097314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099726] [ENSMUST00000174056] [ENSMUST00000176875]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099726
AA Change: T13I

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097314
Gene: ENSMUSG00000075045
AA Change: T13I

DomainStartEndE-ValueType
HOX 5 67 1.13e-11 SMART
internal_repeat_1 86 173 1.27e-12 PROSPERO
internal_repeat_1 177 264 1.27e-12 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000174056
SMART Domains Protein: ENSMUSP00000133909
Gene: ENSMUSG00000075046

DomainStartEndE-ValueType
HOX 2 58 9.45e-5 SMART
HOX 90 152 8.78e-23 SMART
internal_repeat_1 172 207 1.03e-13 PROSPERO
low complexity region 236 247 N/A INTRINSIC
internal_repeat_1 264 299 1.03e-13 PROSPERO
low complexity region 303 323 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176240
Predicted Effect probably benign
Transcript: ENSMUST00000176875
SMART Domains Protein: ENSMUSP00000145004
Gene: ENSMUSG00000075046

DomainStartEndE-ValueType
HOX 18 80 1.7e-13 SMART
HOX 112 174 1.6e-23 SMART
internal_repeat_1 194 371 2.07e-48 PROSPERO
low complexity region 416 436 N/A INTRINSIC
low complexity region 441 456 N/A INTRINSIC
internal_repeat_1 468 645 2.07e-48 PROSPERO
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Arhgef5 A G 6: 43,273,790 I492V probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Ccdc162 T C 10: 41,539,549 probably benign Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Esp24 T A 17: 39,038,316 I11N possibly damaging Het
Exoc4 A G 6: 33,265,975 E41G probably damaging Het
Eya1 T A 1: 14,274,209 probably null Het
Gckr T A 5: 31,300,867 probably null Het
Gria4 T A 9: 4,513,278 D277V probably benign Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Krt90 T A 15: 101,560,593 L171F probably damaging Het
Mthfd1 A G 12: 76,303,749 probably null Het
Olfr262 T C 19: 12,241,590 I24V probably benign Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr786 A T 10: 129,437,307 D165V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc12a5 A G 2: 164,968,431 D10G probably benign Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Sos1 T C 17: 80,406,717 D1108G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Tacc2 A G 7: 130,734,994 T2369A probably benign Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubr5 T C 15: 38,004,235 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Gm4981
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Gm4981 APN 10 58236389 start codon destroyed probably null 0.06
IGL03267:Gm4981 APN 10 58235787 missense probably damaging 0.97
R0021:Gm4981 UTSW 10 58235563 missense probably benign
R0582:Gm4981 UTSW 10 58235686 missense probably benign 0.04
R1857:Gm4981 UTSW 10 58235780 missense probably benign 0.00
R1858:Gm4981 UTSW 10 58235780 missense probably benign 0.00
R1859:Gm4981 UTSW 10 58235780 missense probably benign 0.00
R1984:Gm4981 UTSW 10 58235963 missense possibly damaging 0.53
R2115:Gm4981 UTSW 10 58236251 missense possibly damaging 0.92
R2197:Gm4981 UTSW 10 58236336 missense possibly damaging 0.71
R3014:Gm4981 UTSW 10 58235534 missense possibly damaging 0.86
R3983:Gm4981 UTSW 10 58235801 missense possibly damaging 0.95
R4500:Gm4981 UTSW 10 58235706 missense possibly damaging 0.70
R4939:Gm4981 UTSW 10 58235603 missense probably benign 0.33
R5460:Gm4981 UTSW 10 58235895 missense possibly damaging 0.94
R6228:Gm4981 UTSW 10 58235522 missense probably benign 0.02
R8282:Gm4981 UTSW 10 58236326 missense possibly damaging 0.71
Z1088:Gm4981 UTSW 10 58235911 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCAAGTCTTGATCTTGAGCTGTG -3'
(R):5'- ACTTTTAGGTGCTGGCCAGG -3'

Sequencing Primer
(F):5'- ATCTTGAGCTGTGGGCCTGC -3'
(R):5'- TGCTGGCCAGGCAAATG -3'
Posted On2015-02-18