Incidental Mutation 'R3412:Ramp2'
ID267778
Institutional Source Beutler Lab
Gene Symbol Ramp2
Ensembl Gene ENSMUSG00000001240
Gene Namereceptor (calcitonin) activity modifying protein 2
Synonyms
MMRRC Submission 040630-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3412 (G1)
Quality Score107
Status Validated
Chromosome11
Chromosomal Location101246028-101259546 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TTGCTGCTGCTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTG at 101246545 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107282] [ENSMUST00000122006] [ENSMUST00000128260] [ENSMUST00000129680] [ENSMUST00000149585] [ENSMUST00000151830]
Predicted Effect probably benign
Transcript: ENSMUST00000107282
SMART Domains Protein: ENSMUSP00000102903
Gene: ENSMUSG00000001240

DomainStartEndE-ValueType
Pfam:RAMP 29 140 1.5e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122006
SMART Domains Protein: ENSMUSP00000114061
Gene: ENSMUSG00000001240

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
PDB:2XVT|F 71 105 3e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000128260
SMART Domains Protein: ENSMUSP00000127718
Gene: ENSMUSG00000001240

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129680
SMART Domains Protein: ENSMUSP00000122072
Gene: ENSMUSG00000001240

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Pfam:RAMP 80 187 6.7e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149006
Predicted Effect probably benign
Transcript: ENSMUST00000149585
SMART Domains Protein: ENSMUSP00000116331
Gene: ENSMUSG00000001240

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151830
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RAMP family of single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. RAMPs are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin-gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of this (RAMP2) protein, CRLR functions as an adrenomedullin receptor. The RAMP2 protein is involved in core glycosylation and transportation of adrenomedullin receptor to the cell surface. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality. Mice heterozygous for the null allele exhibit decreased litter size beyond the loss of homozygous embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Arhgef5 A G 6: 43,273,790 I492V probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Ccdc162 T C 10: 41,539,549 probably benign Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Esp24 T A 17: 39,038,316 I11N possibly damaging Het
Exoc4 A G 6: 33,265,975 E41G probably damaging Het
Eya1 T A 1: 14,274,209 probably null Het
Gckr T A 5: 31,300,867 probably null Het
Gm4981 G A 10: 58,236,353 T13I possibly damaging Het
Gria4 T A 9: 4,513,278 D277V probably benign Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Krt90 T A 15: 101,560,593 L171F probably damaging Het
Mthfd1 A G 12: 76,303,749 probably null Het
Olfr262 T C 19: 12,241,590 I24V probably benign Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr786 A T 10: 129,437,307 D165V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc12a5 A G 2: 164,968,431 D10G probably benign Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Sos1 T C 17: 80,406,717 D1108G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Tacc2 A G 7: 130,734,994 T2369A probably benign Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubr5 T C 15: 38,004,235 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Ramp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Ramp2 APN 11 101247627 missense probably benign 0.37
R1518:Ramp2 UTSW 11 101247582 missense probably benign 0.22
R2218:Ramp2 UTSW 11 101247631 missense probably benign 0.00
R2566:Ramp2 UTSW 11 101246545 unclassified probably benign
R4967:Ramp2 UTSW 11 101247557 splice site probably null
R4998:Ramp2 UTSW 11 101247421 intron probably benign
R7436:Ramp2 UTSW 11 101247939 missense possibly damaging 0.94
R8086:Ramp2 UTSW 11 101247936 missense probably damaging 1.00
X0018:Ramp2 UTSW 11 101246545 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAGTGGATCGCAGTTCACGG -3'
(R):5'- ATTCAGGACCCATCTGCAGTTC -3'

Sequencing Primer
(F):5'- ATCGCAGTTCACGGGGTACAG -3'
(R):5'- TCTGCAGTTCAGAGGTGCTCC -3'
Posted On2015-02-18