Incidental Mutation 'R3412:Mthfd1'
ID267779
Institutional Source Beutler Lab
Gene Symbol Mthfd1
Ensembl Gene ENSMUSG00000021048
Gene Namemethylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase
SynonymsMthfd, DCS, E430024A07Rik
MMRRC Submission 040630-MU
Accession Numbers

Genbank: NM_138745; MGI: 1342005

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3412 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location76255298-76319803 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 76303749 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021443] [ENSMUST00000220046] [ENSMUST00000220321]
Predicted Effect probably null
Transcript: ENSMUST00000021443
SMART Domains Protein: ENSMUSP00000021443
Gene: ENSMUSG00000021048

DomainStartEndE-ValueType
Pfam:THF_DHG_CYH 6 125 1.7e-36 PFAM
Pfam:THF_DHG_CYH_C 128 295 1.1e-67 PFAM
Pfam:FTHFS 317 935 4.1e-259 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218513
Predicted Effect probably null
Transcript: ENSMUST00000220046
Predicted Effect probably benign
Transcript: ENSMUST00000220321
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes a trifunctional cytoplasmic enzyme. The encoded protein functions as a methylenetetrahydrofolate dehydrogenase, a methenyltetrahydrofolate cyclohydrolase, and a formyltetrahydrofolate synthase. The encoded enzyme functions in de novo synthesis of purines and thymidylate and in regeneration of methionine from homocysteine. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality. Mice heterozygous for a gene trap allele exhibit altered amino acid levels and nucleotide metabolism related to dietary folate and choline concentrations. [provided by MGI curators]
Allele List at MGI

All alleles(57) : Targeted, other(2) Gene trapped(54) Radiation induced(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Arhgef5 A G 6: 43,273,790 I492V probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Ccdc162 T C 10: 41,539,549 probably benign Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Esp24 T A 17: 39,038,316 I11N possibly damaging Het
Exoc4 A G 6: 33,265,975 E41G probably damaging Het
Eya1 T A 1: 14,274,209 probably null Het
Gckr T A 5: 31,300,867 probably null Het
Gm4981 G A 10: 58,236,353 T13I possibly damaging Het
Gria4 T A 9: 4,513,278 D277V probably benign Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Krt90 T A 15: 101,560,593 L171F probably damaging Het
Olfr262 T C 19: 12,241,590 I24V probably benign Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr786 A T 10: 129,437,307 D165V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc12a5 A G 2: 164,968,431 D10G probably benign Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Sos1 T C 17: 80,406,717 D1108G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Tacc2 A G 7: 130,734,994 T2369A probably benign Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubr5 T C 15: 38,004,235 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Mthfd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Mthfd1 APN 12 76300439 missense possibly damaging 0.79
IGL01996:Mthfd1 APN 12 76303905 missense probably damaging 1.00
IGL02399:Mthfd1 APN 12 76317632 missense probably damaging 1.00
IGL02529:Mthfd1 APN 12 76303709 missense probably benign 0.02
3-1:Mthfd1 UTSW 12 76314400 critical splice acceptor site probably null
R0062:Mthfd1 UTSW 12 76297589 splice site probably benign
R0062:Mthfd1 UTSW 12 76297589 splice site probably benign
R0732:Mthfd1 UTSW 12 76294174 missense probably damaging 1.00
R1572:Mthfd1 UTSW 12 76270419 nonsense probably null
R1918:Mthfd1 UTSW 12 76314976 missense probably damaging 1.00
R2008:Mthfd1 UTSW 12 76297519 missense probably damaging 1.00
R2280:Mthfd1 UTSW 12 76280492 missense probably benign 0.37
R2857:Mthfd1 UTSW 12 76288925 missense probably damaging 0.99
R2859:Mthfd1 UTSW 12 76288925 missense probably damaging 0.99
R2997:Mthfd1 UTSW 12 76315036 missense probably benign 0.01
R3034:Mthfd1 UTSW 12 76289470 missense probably benign 0.04
R3153:Mthfd1 UTSW 12 76311963 missense probably benign
R4135:Mthfd1 UTSW 12 76282874 splice site probably null
R4245:Mthfd1 UTSW 12 76301273 missense probably damaging 0.99
R4498:Mthfd1 UTSW 12 76314990 missense probably damaging 1.00
R4573:Mthfd1 UTSW 12 76294138 critical splice acceptor site probably null
R5022:Mthfd1 UTSW 12 76294374 missense probably damaging 1.00
R5022:Mthfd1 UTSW 12 76301328 missense probably damaging 1.00
R5037:Mthfd1 UTSW 12 76294140 missense probably damaging 1.00
R5455:Mthfd1 UTSW 12 76301288 missense probably benign 0.20
R5879:Mthfd1 UTSW 12 76294218 missense probably benign 0.00
R5902:Mthfd1 UTSW 12 76291052 missense probably benign 0.01
R6119:Mthfd1 UTSW 12 76303673 missense probably damaging 1.00
R6199:Mthfd1 UTSW 12 76288911 missense probably damaging 1.00
R6199:Mthfd1 UTSW 12 76303680 missense probably damaging 1.00
R6931:Mthfd1 UTSW 12 76303698 missense probably benign
R7405:Mthfd1 UTSW 12 76311874 missense probably damaging 0.98
R7658:Mthfd1 UTSW 12 76270435 missense probably damaging 1.00
R8053:Mthfd1 UTSW 12 76280508 missense probably damaging 1.00
R8493:Mthfd1 UTSW 12 76294155 missense probably damaging 1.00
X0012:Mthfd1 UTSW 12 76314408 missense possibly damaging 0.75
Z1176:Mthfd1 UTSW 12 76303967 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GATTTTCCTCCCAGAAGGTCC -3'
(R):5'- CTGACAGTGGCAACCAGAAC -3'

Sequencing Primer
(F):5'- CCTTTGGCTCCTGTGGC -3'
(R):5'- CCAGAACCACCACGTGTG -3'
Posted On2015-02-18