Incidental Mutation 'R3412:Adarb2'
ID267780
Institutional Source Beutler Lab
Gene Symbol Adarb2
Ensembl Gene ENSMUSG00000052551
Gene Nameadenosine deaminase, RNA-specific, B2
SynonymsAdar3, RED2
MMRRC Submission 040630-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3412 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location8202866-8768747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8752618 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 643 (F643S)
Ref Sequence ENSEMBL: ENSMUSP00000120757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064473] [ENSMUST00000123187] [ENSMUST00000135574]
Predicted Effect probably damaging
Transcript: ENSMUST00000064473
AA Change: F643S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064775
Gene: ENSMUSG00000052551
AA Change: F643S

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
DSRM 126 190 1.03e-16 SMART
DSRM 284 346 1.24e-15 SMART
ADEAMc 366 742 5.41e-211 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123187
AA Change: F643S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120757
Gene: ENSMUSG00000052551
AA Change: F643S

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
DSRM 126 190 6.1e-19 SMART
DSRM 284 346 7.3e-18 SMART
ADEAMc 366 698 2e-164 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135574
AA Change: F643S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115148
Gene: ENSMUSG00000052551
AA Change: F643S

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
DSRM 126 190 1.03e-16 SMART
DSRM 284 346 1.24e-15 SMART
ADEAMc 366 742 5.41e-211 SMART
Meta Mutation Damage Score 0.6463 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the double-stranded RNA adenosine deaminase family of RNA-editing enzymes and may play a regulatory role in RNA editing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Arhgef5 A G 6: 43,273,790 I492V probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Ccdc162 T C 10: 41,539,549 probably benign Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Esp24 T A 17: 39,038,316 I11N possibly damaging Het
Exoc4 A G 6: 33,265,975 E41G probably damaging Het
Eya1 T A 1: 14,274,209 probably null Het
Gckr T A 5: 31,300,867 probably null Het
Gm4981 G A 10: 58,236,353 T13I possibly damaging Het
Gria4 T A 9: 4,513,278 D277V probably benign Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Krt90 T A 15: 101,560,593 L171F probably damaging Het
Mthfd1 A G 12: 76,303,749 probably null Het
Olfr262 T C 19: 12,241,590 I24V probably benign Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr786 A T 10: 129,437,307 D165V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc12a5 A G 2: 164,968,431 D10G probably benign Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Sos1 T C 17: 80,406,717 D1108G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Tacc2 A G 7: 130,734,994 T2369A probably benign Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubr5 T C 15: 38,004,235 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Adarb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Adarb2 APN 13 8701725 missense probably benign 0.00
IGL00910:Adarb2 APN 13 8672433 missense probably damaging 1.00
IGL01308:Adarb2 APN 13 8203293 missense possibly damaging 0.93
IGL01337:Adarb2 APN 13 8570246 missense probably benign 0.03
IGL01508:Adarb2 APN 13 8752570 splice site probably null
IGL01792:Adarb2 APN 13 8570149 missense probably damaging 1.00
IGL02387:Adarb2 APN 13 8569958 missense probably damaging 1.00
IGL02423:Adarb2 APN 13 8569720 missense probably damaging 0.99
R0304:Adarb2 UTSW 13 8752570 splice site probably benign
R0463:Adarb2 UTSW 13 8203188 start gained probably benign
R0646:Adarb2 UTSW 13 8731819 missense probably damaging 1.00
R0963:Adarb2 UTSW 13 8672415 missense probably damaging 1.00
R1066:Adarb2 UTSW 13 8757323 missense probably benign 0.14
R1451:Adarb2 UTSW 13 8339621 intron probably benign
R1656:Adarb2 UTSW 13 8203251 missense unknown
R1939:Adarb2 UTSW 13 8203322 critical splice donor site probably null
R2212:Adarb2 UTSW 13 8752618 missense probably damaging 1.00
R2484:Adarb2 UTSW 13 8569774 nonsense probably null
R2993:Adarb2 UTSW 13 8713716 missense probably benign 0.02
R3157:Adarb2 UTSW 13 8697633 missense probably benign 0.20
R3177:Adarb2 UTSW 13 8752627 missense probably damaging 1.00
R3277:Adarb2 UTSW 13 8752627 missense probably damaging 1.00
R3949:Adarb2 UTSW 13 8570419 missense probably damaging 0.97
R4505:Adarb2 UTSW 13 8697691 missense probably damaging 1.00
R5232:Adarb2 UTSW 13 8713640 missense possibly damaging 0.80
R5831:Adarb2 UTSW 13 8559133 missense probably benign 0.45
R7113:Adarb2 UTSW 13 8731845 missense probably damaging 0.99
R7252:Adarb2 UTSW 13 8570180 missense probably benign 0.00
R7259:Adarb2 UTSW 13 8570252 missense probably benign
R7346:Adarb2 UTSW 13 8570384 missense probably damaging 1.00
R7422:Adarb2 UTSW 13 8757277 missense possibly damaging 0.83
R7724:Adarb2 UTSW 13 8570256 missense probably benign 0.34
R7733:Adarb2 UTSW 13 8752608 missense possibly damaging 0.82
R7749:Adarb2 UTSW 13 8569739 missense possibly damaging 0.96
Z1177:Adarb2 UTSW 13 8570200 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTAGAACTGTGCCTTCACGC -3'
(R):5'- TTTAACCAGAGCCCAGGTACG -3'

Sequencing Primer
(F):5'- CCTTCACGCGACTGAGTGTTAAG -3'
(R):5'- GGCTAATTTTCTCCCCAGAAAGG -3'
Posted On2015-02-18