Mutagenetix > Incidental Mutations

Incidental Mutation 'R3412:Ubr5'

267781

Institutional Source

Beutler Lab

Gene Symbol

Ubr5

Ensembl Gene

ENSMUSG00000037487

Gene Name

ubiquitin protein ligase E3 component n-recognin 5

Synonyms

Edd, 4432411E13Rik, Edd1

MMRRC Submission

040630-MU

Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3412 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37967328-38078854 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 38004235 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154293 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000110336] [ENSMUST00000226414]

Predicted Effect

probably benign
Transcript: ENSMUST00000110336

SMART Domains

Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487

Domain	Start	End	E-Value	Type
low complexity region	94	111	N/A	INTRINSIC
low complexity region	129	156	N/A	INTRINSIC
Pfam:E3_UbLigase_EDD	179	230	9.7e-35	PFAM
low complexity region	282	323	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
low complexity region	860	870	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
low complexity region	970	999	N/A	INTRINSIC
low complexity region	1140	1151	N/A	INTRINSIC
ZnF_UBR1	1177	1244	5.42e-27	SMART
low complexity region	1396	1405	N/A	INTRINSIC
low complexity region	1524	1537	N/A	INTRINSIC
low complexity region	1567	1613	N/A	INTRINSIC
low complexity region	1641	1657	N/A	INTRINSIC
low complexity region	1662	1687	N/A	INTRINSIC
low complexity region	1726	1742	N/A	INTRINSIC
low complexity region	1759	1789	N/A	INTRINSIC
low complexity region	1879	1890	N/A	INTRINSIC
low complexity region	1972	1983	N/A	INTRINSIC
low complexity region	1986	1997	N/A	INTRINSIC
Blast:HECTc	2271	2313	2e-6	BLAST
low complexity region	2329	2366	N/A	INTRINSIC
PolyA	2389	2452	3.97e-33	SMART
HECTc	2432	2798	1e-151	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110336

SMART Domains

Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487

Domain	Start	End	E-Value	Type
low complexity region	94	111	N/A	INTRINSIC
low complexity region	129	156	N/A	INTRINSIC
Pfam:E3_UbLigase_EDD	179	230	9.7e-35	PFAM
low complexity region	282	323	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
low complexity region	860	870	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
low complexity region	970	999	N/A	INTRINSIC
low complexity region	1140	1151	N/A	INTRINSIC
ZnF_UBR1	1177	1244	5.42e-27	SMART
low complexity region	1396	1405	N/A	INTRINSIC
low complexity region	1524	1537	N/A	INTRINSIC
low complexity region	1567	1613	N/A	INTRINSIC
low complexity region	1641	1657	N/A	INTRINSIC
low complexity region	1662	1687	N/A	INTRINSIC
low complexity region	1726	1742	N/A	INTRINSIC
low complexity region	1759	1789	N/A	INTRINSIC
low complexity region	1879	1890	N/A	INTRINSIC
low complexity region	1972	1983	N/A	INTRINSIC
low complexity region	1986	1997	N/A	INTRINSIC
Blast:HECTc	2271	2313	2e-6	BLAST
low complexity region	2329	2366	N/A	INTRINSIC
PolyA	2389	2452	3.97e-33	SMART
HECTc	2432	2798	1e-151	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226137

Predicted Effect

probably benign
Transcript: ENSMUST00000226414

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228101

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228174

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228504

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (40/41)

MGI Phenotype

Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adarb2	T	C	13: 8,752,618	F643S	probably damaging	Het
Ap2a2	T	A	7: 141,598,776	N105K	probably benign	Het
Arhgef5	A	G	6: 43,273,790	I492V	probably benign	Het
Atp8b4	C	A	2: 126,375,757	W613L	probably damaging	Het
Ccdc162	T	C	10: 41,539,549		probably benign	Het
Diexf	A	C	1: 193,128,502	S64R	possibly damaging	Het
Esp24	T	A	17: 39,038,316	I11N	possibly damaging	Het
Exoc4	A	G	6: 33,265,975	E41G	probably damaging	Het
Eya1	T	A	1: 14,274,209		probably null	Het
Gckr	T	A	5: 31,300,867		probably null	Het
Gm4981	G	A	10: 58,236,353	T13I	possibly damaging	Het
Gria4	T	A	9: 4,513,278	D277V	probably benign	Het
Il18r1	A	T	1: 40,491,067	D318V	probably damaging	Het
Il4i1	T	C	7: 44,836,658	L22P	probably damaging	Het
Inpp5d	C	A	1: 87,668,057	T175N	possibly damaging	Het
Krt90	T	A	15: 101,560,593	L171F	probably damaging	Het
Mthfd1	A	G	12: 76,303,749		probably null	Het
Olfr262	T	C	19: 12,241,590	I24V	probably benign	Het
Olfr561	T	C	7: 102,774,755	L77P	possibly damaging	Het
Olfr635	T	C	7: 103,979,402	L76P	probably damaging	Het
Olfr786	A	T	10: 129,437,307	D165V	probably damaging	Het
Pla2g4f	T	C	2: 120,303,106	S579G	probably benign	Het
Ppef2	T	G	5: 92,228,722	S649R	probably damaging	Het
Prss43	G	C	9: 110,829,464	Q277H	probably damaging	Het
Ramp2	TTGCTGCTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTG	11: 101,246,545		probably benign	Het
Rusc2	T	G	4: 43,415,935	S414A	probably damaging	Het
Sez6l	A	G	5: 112,475,361	L108P	possibly damaging	Het
Slc12a5	A	G	2: 164,968,431	D10G	probably benign	Het
Slc1a7	A	G	4: 108,010,994	E497G	probably benign	Het
Sos1	T	C	17: 80,406,717	D1108G	probably benign	Het
Spag8	T	A	4: 43,651,606	S423C	probably damaging	Het
Tacc2	A	G	7: 130,734,994	T2369A	probably benign	Het
Taok2	T	C	7: 126,870,858	I933V	possibly damaging	Het
Tex9	C	A	9: 72,477,758	Q265H	possibly damaging	Het
Trim69	T	C	2: 122,178,644	V395A	probably benign	Het
Tusc1	C	A	4: 93,334,936	R162L	probably damaging	Het
Zfyve28	C	T	5: 34,199,684	M723I	probably benign	Het
Zmynd8	A	T	2: 165,815,451	M533K	probably damaging	Het

Other mutations in Ubr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ubr5	APN	15	37984036	missense	probably damaging	1.00
IGL00548:Ubr5	APN	15	38004321	missense	probably benign	0.11
IGL00675:Ubr5	APN	15	38018284	missense	possibly damaging	0.84
IGL00770:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00774:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00919:Ubr5	APN	15	38040842	missense	probably damaging	1.00
IGL00962:Ubr5	APN	15	37985934	missense	probably damaging	1.00
IGL01328:Ubr5	APN	15	37981523	missense	possibly damaging	0.82
IGL01359:Ubr5	APN	15	37973006	missense	probably damaging	0.96
IGL01394:Ubr5	APN	15	38009631	missense	possibly damaging	0.90
IGL01674:Ubr5	APN	15	37998379	missense	probably damaging	1.00
IGL01981:Ubr5	APN	15	37996598	missense	probably benign	0.08
IGL01993:Ubr5	APN	15	37973012	missense	probably damaging	0.99
IGL02159:Ubr5	APN	15	37991379	splice site	probably benign
IGL02252:Ubr5	APN	15	38024894	missense	probably damaging	1.00
IGL02442:Ubr5	APN	15	38037901	missense	possibly damaging	0.95
IGL02502:Ubr5	APN	15	38030689	missense	probably benign	0.01
IGL02503:Ubr5	APN	15	38018320	missense	possibly damaging	0.90
IGL02503:Ubr5	APN	15	38018314	missense	probably damaging	0.99
IGL02546:Ubr5	APN	15	38008747	missense	probably benign	0.00
IGL02556:Ubr5	APN	15	38002448	missense	probably benign	0.18
IGL02647:Ubr5	APN	15	37992082	missense	probably damaging	0.99
IGL02679:Ubr5	APN	15	38002314	missense	probably benign	0.36
IGL02726:Ubr5	APN	15	38000562	splice site	probably benign
IGL02884:Ubr5	APN	15	37998376	missense	probably damaging	1.00
IGL02972:Ubr5	APN	15	38041952	missense	probably damaging	1.00
IGL03000:Ubr5	APN	15	38024852	missense	probably damaging	0.99
IGL03028:Ubr5	APN	15	38047593	missense	probably benign	0.00
IGL03057:Ubr5	APN	15	38040906	splice site	probably benign
IGL03085:Ubr5	APN	15	38029568	missense	probably damaging	1.00
IGL03198:Ubr5	APN	15	38045720	missense	probably damaging	1.00
IGL03368:Ubr5	APN	15	37998316	missense	probably damaging	0.96
P0016:Ubr5	UTSW	15	38000578	missense	probably damaging	1.00
PIT4142001:Ubr5	UTSW	15	38041909	missense	probably damaging	0.98
R0133:Ubr5	UTSW	15	37996571	missense	probably damaging	0.98
R0173:Ubr5	UTSW	15	38004675	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0314:Ubr5	UTSW	15	37997187	missense	probably damaging	0.99
R0379:Ubr5	UTSW	15	38018957	missense	probably benign	0.00
R0390:Ubr5	UTSW	15	38030672	missense	probably benign	0.19
R0415:Ubr5	UTSW	15	37972980	missense	probably damaging	0.98
R0531:Ubr5	UTSW	15	37991344	missense	probably benign	0.34
R0650:Ubr5	UTSW	15	38030807	splice site	probably benign
R0720:Ubr5	UTSW	15	37972991	missense	probably damaging	0.98
R1183:Ubr5	UTSW	15	37997175	missense	possibly damaging	0.71
R1302:Ubr5	UTSW	15	38041479	missense	possibly damaging	0.91
R1442:Ubr5	UTSW	15	38014924	splice site	probably benign
R1507:Ubr5	UTSW	15	37980870	missense	probably damaging	1.00
R1575:Ubr5	UTSW	15	38040841	missense	probably damaging	1.00
R1577:Ubr5	UTSW	15	38030730	missense	possibly damaging	0.76
R1622:Ubr5	UTSW	15	38009113	unclassified	probably benign
R1721:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1799:Ubr5	UTSW	15	37989377	missense	probably damaging	1.00
R1840:Ubr5	UTSW	15	37980917	missense	possibly damaging	0.51
R1867:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1868:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R2065:Ubr5	UTSW	15	38040842	missense	probably damaging	1.00
R2107:Ubr5	UTSW	15	37989302	missense	probably benign	0.00
R2201:Ubr5	UTSW	15	38002299	missense	possibly damaging	0.83
R2261:Ubr5	UTSW	15	37988284	missense	probably damaging	0.99
R2441:Ubr5	UTSW	15	37989345	missense	probably damaging	0.99
R2512:Ubr5	UTSW	15	38002319	missense	probably damaging	1.00
R3008:Ubr5	UTSW	15	38030845	missense	probably benign
R3898:Ubr5	UTSW	15	37997739	missense	probably benign	0.02
R3900:Ubr5	UTSW	15	38019242	missense	probably damaging	1.00
R4032:Ubr5	UTSW	15	38024837	missense	probably benign	0.22
R4352:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R4362:Ubr5	UTSW	15	38078403	missense	probably damaging	0.99
R4467:Ubr5	UTSW	15	38004336	missense	probably damaging	1.00
R4507:Ubr5	UTSW	15	38013542	missense	probably damaging	0.96
R4683:Ubr5	UTSW	15	38037967	missense	probably damaging	1.00
R4771:Ubr5	UTSW	15	38018297	missense	possibly damaging	0.50
R4878:Ubr5	UTSW	15	38006564	missense	probably benign	0.01
R4999:Ubr5	UTSW	15	38009668	missense	probably benign	0.06
R5057:Ubr5	UTSW	15	38004109	missense	probably damaging	0.98
R5177:Ubr5	UTSW	15	38006517	missense	probably benign	0.22
R5186:Ubr5	UTSW	15	37997916	missense	probably damaging	0.99
R5378:Ubr5	UTSW	15	37989578	missense	probably damaging	1.00
R5486:Ubr5	UTSW	15	38008739	missense	probably benign	0.00
R5494:Ubr5	UTSW	15	38019281	missense	possibly damaging	0.78
R5617:Ubr5	UTSW	15	38030657	missense	possibly damaging	0.47
R5636:Ubr5	UTSW	15	37983996	missense	probably damaging	1.00
R5655:Ubr5	UTSW	15	38015093	missense	probably damaging	0.99
R5715:Ubr5	UTSW	15	38002233	missense	probably benign	0.06
R5781:Ubr5	UTSW	15	38006541	missense	probably benign	0.27
R6645:Ubr5	UTSW	15	38029506	missense	probably damaging	1.00
R6774:Ubr5	UTSW	15	38015135	missense	probably damaging	1.00
R6823:Ubr5	UTSW	15	37989598	missense	probably benign	0.08
R6877:Ubr5	UTSW	15	38002570	missense	probably damaging	0.98
R7105:Ubr5	UTSW	15	38008775	missense
R7166:Ubr5	UTSW	15	37976145	missense
R7514:Ubr5	UTSW	15	37988237	missense
R7523:Ubr5	UTSW	15	38004055	missense
R7631:Ubr5	UTSW	15	38029507	missense
R7709:Ubr5	UTSW	15	37979832	missense	probably null
R7710:Ubr5	UTSW	15	37979832	missense	probably null
R7712:Ubr5	UTSW	15	37979832	missense	probably null
R7803:Ubr5	UTSW	15	37979832	missense	probably null
R7816:Ubr5	UTSW	15	37979832	missense	probably null
R7817:Ubr5	UTSW	15	37979832	missense	probably null
R7821:Ubr5	UTSW	15	37997187	missense	probably damaging	0.96
R7824:Ubr5	UTSW	15	37991322	missense	probably damaging	0.97
R7841:Ubr5	UTSW	15	37980906	missense
R7869:Ubr5	UTSW	15	37979832	missense	probably null
R7896:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R7924:Ubr5	UTSW	15	37980906	missense
R7952:Ubr5	UTSW	15	37979832	missense	probably null
R7979:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
RF024:Ubr5	UTSW	15	38028652	missense
X0024:Ubr5	UTSW	15	37992060	missense	probably damaging	1.00
Z1177:Ubr5	UTSW	15	38040755	missense

Predicted Primers

PCR Primer
(F):5'- ACATACGGATCTTTGTTCTCTTGTG -3'
(R):5'- TGGTCACCCTACCAAACAGTAG -3'

Sequencing Primer
(F):5'- GTTCTCTTGTGACCCAAACATAATC -3'
(R):5'- ACATGCTGGTGCCACCC -3'

Posted On

2015-02-18