Incidental Mutation 'R3412:Krt90'
ID267782
Institutional Source Beutler Lab
Gene Symbol Krt90
Ensembl Gene ENSMUSG00000048699
Gene Namekeratin 90
Synonyms4732456N10Rik
MMRRC Submission 040630-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3412 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101552356-101562950 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101560593 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 171 (L171F)
Ref Sequence ENSEMBL: ENSMUSP00000023714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023714] [ENSMUST00000042957]
Predicted Effect probably damaging
Transcript: ENSMUST00000023714
AA Change: L171F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023714
Gene: ENSMUSG00000048699
AA Change: L171F

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 139 3.1e-24 PFAM
Filament 142 453 1.05e-179 SMART
low complexity region 465 522 N/A INTRINSIC
low complexity region 527 535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042957
SMART Domains Protein: ENSMUSP00000036246
Gene: ENSMUSG00000022986

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 146 1e-32 PFAM
Filament 149 462 1.68e-178 SMART
low complexity region 468 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197418
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit partial prenatal lethality and thickened long toenails. An increased caudal vertebrae number is observed in some mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Arhgef5 A G 6: 43,273,790 I492V probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Ccdc162 T C 10: 41,539,549 probably benign Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Esp24 T A 17: 39,038,316 I11N possibly damaging Het
Exoc4 A G 6: 33,265,975 E41G probably damaging Het
Eya1 T A 1: 14,274,209 probably null Het
Gckr T A 5: 31,300,867 probably null Het
Gm4981 G A 10: 58,236,353 T13I possibly damaging Het
Gria4 T A 9: 4,513,278 D277V probably benign Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Mthfd1 A G 12: 76,303,749 probably null Het
Olfr262 T C 19: 12,241,590 I24V probably benign Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr786 A T 10: 129,437,307 D165V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc12a5 A G 2: 164,968,431 D10G probably benign Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Sos1 T C 17: 80,406,717 D1108G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Tacc2 A G 7: 130,734,994 T2369A probably benign Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubr5 T C 15: 38,004,235 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Krt90
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0243:Krt90 UTSW 15 101562675 missense possibly damaging 0.78
R0732:Krt90 UTSW 15 101560425 missense possibly damaging 0.60
R1036:Krt90 UTSW 15 101562716 missense probably benign 0.05
R1616:Krt90 UTSW 15 101560591 missense possibly damaging 0.46
R1750:Krt90 UTSW 15 101553365 unclassified probably benign
R1919:Krt90 UTSW 15 101557230 missense probably damaging 1.00
R2063:Krt90 UTSW 15 101558359 missense probably benign 0.07
R2107:Krt90 UTSW 15 101562629 missense probably benign 0.06
R2155:Krt90 UTSW 15 101562611 missense probably benign 0.00
R2404:Krt90 UTSW 15 101554670 critical splice donor site probably null
R3910:Krt90 UTSW 15 101562783 missense probably damaging 1.00
R3911:Krt90 UTSW 15 101562783 missense probably damaging 1.00
R3913:Krt90 UTSW 15 101562783 missense probably damaging 1.00
R4476:Krt90 UTSW 15 101557283 missense probably damaging 1.00
R4748:Krt90 UTSW 15 101555333 missense probably damaging 1.00
R4918:Krt90 UTSW 15 101562479 missense possibly damaging 0.47
R5883:Krt90 UTSW 15 101553219 unclassified probably benign
R6416:Krt90 UTSW 15 101559244 missense probably benign 0.12
R6674:Krt90 UTSW 15 101557326 missense probably damaging 0.99
R7025:Krt90 UTSW 15 101557175 missense possibly damaging 0.81
R7514:Krt90 UTSW 15 101553170 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTTGAAGTCCTCCACCACG -3'
(R):5'- TGGACCTGTCATTTGCTTCG -3'

Sequencing Primer
(F):5'- GAAGTCCTCCACCACGTCCTG -3'
(R):5'- TGTACCAACACTGACTTGACTC -3'
Posted On2015-02-18