Incidental Mutation 'R3412:Sos1'
ID267784
Institutional Source Beutler Lab
Gene Symbol Sos1
Ensembl Gene ENSMUSG00000024241
Gene NameSOS Ras/Rac guanine nucleotide exchange factor 1
Synonyms4430401P03Rik
MMRRC Submission 040630-MU
Accession Numbers

Genbank: NM_009231.2; Ensembl: ENSMUST00000068714

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3412 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location80393752-80480453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80406717 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1108 (D1108G)
Ref Sequence ENSEMBL: ENSMUSP00000067786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068714]
PDB Structure
CRK SH3 DOMAIN COMPLEXED WITH PEPTOID INHIBITOR [X-RAY DIFFRACTION]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
PLECKSTRIN HOMOLOGY DOMAIN OF SON OF SEVENLESS 1 (SOS1) WITH GLYCINE-SERINE ADDED TO THE N-TERMINUS, NMR, 20 STRUCTURES [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, 15 STRUCTURES [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, 15 STRUCTURES [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000068714
AA Change: D1108G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067786
Gene: ENSMUSG00000024241
AA Change: D1108G

DomainStartEndE-ValueType
Pfam:Histone 40 169 6.8e-16 PFAM
RhoGEF 204 389 8.5e-35 SMART
PH 444 548 2.44e-17 SMART
RasGEFN 596 741 2.18e-56 SMART
RasGEF 776 1020 4.44e-102 SMART
low complexity region 1079 1093 N/A INTRINSIC
low complexity region 1116 1127 N/A INTRINSIC
low complexity region 1132 1154 N/A INTRINSIC
Blast:RasGEF 1155 1306 1e-51 BLAST
Meta Mutation Damage Score 0.0585 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins. The product of this gene may regulate RAS proteins by facilitating the exchange of GTP for GDP. Mutations in this gene are associated with gingival fibromatosis 1 and Noonan syndrome type 4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutant embryos exhibit placental and cardiovascular defects resulting in death around mid-gestation. When heterozygous, these mutations enhance the eye defects of homozygous mutants of the epidermal growth factor receptor gene. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(21)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Arhgef5 A G 6: 43,273,790 I492V probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Ccdc162 T C 10: 41,539,549 probably benign Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Esp24 T A 17: 39,038,316 I11N possibly damaging Het
Exoc4 A G 6: 33,265,975 E41G probably damaging Het
Eya1 T A 1: 14,274,209 probably null Het
Gckr T A 5: 31,300,867 probably null Het
Gm4981 G A 10: 58,236,353 T13I possibly damaging Het
Gria4 T A 9: 4,513,278 D277V probably benign Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Krt90 T A 15: 101,560,593 L171F probably damaging Het
Mthfd1 A G 12: 76,303,749 probably null Het
Olfr262 T C 19: 12,241,590 I24V probably benign Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr786 A T 10: 129,437,307 D165V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc12a5 A G 2: 164,968,431 D10G probably benign Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Tacc2 A G 7: 130,734,994 T2369A probably benign Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubr5 T C 15: 38,004,235 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Sos1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Sos1 APN 17 80398524 missense possibly damaging 0.94
IGL00915:Sos1 APN 17 80433938 missense probably benign 0.00
IGL00929:Sos1 APN 17 80408596 missense probably damaging 1.00
IGL01073:Sos1 APN 17 80422747 missense probably damaging 1.00
IGL01116:Sos1 APN 17 80445500 missense probably damaging 1.00
IGL01533:Sos1 APN 17 80415082 missense probably damaging 0.97
IGL01546:Sos1 APN 17 80408611 missense probably damaging 1.00
IGL01583:Sos1 APN 17 80433900 missense probably benign 0.11
IGL01628:Sos1 APN 17 80422677 splice site probably benign
IGL01837:Sos1 APN 17 80422728 missense probably damaging 1.00
IGL02170:Sos1 APN 17 80398290 missense probably damaging 0.99
IGL02426:Sos1 APN 17 80434943 missense possibly damaging 0.82
IGL02992:Sos1 APN 17 80419016 missense probably benign 0.01
IGL03037:Sos1 APN 17 80420329 missense probably damaging 0.98
1mM(1):Sos1 UTSW 17 80455057 missense possibly damaging 0.46
PIT4354001:Sos1 UTSW 17 80449356 missense possibly damaging 0.52
R0056:Sos1 UTSW 17 80413621 missense probably damaging 1.00
R0348:Sos1 UTSW 17 80408311 missense probably benign
R0373:Sos1 UTSW 17 80453763 missense probably damaging 1.00
R0477:Sos1 UTSW 17 80434934 missense possibly damaging 0.92
R0621:Sos1 UTSW 17 80451979 critical splice donor site probably null
R0839:Sos1 UTSW 17 80433730 missense probably damaging 1.00
R1174:Sos1 UTSW 17 80445608 nonsense probably null
R1490:Sos1 UTSW 17 80413675 missense probably benign 0.11
R1566:Sos1 UTSW 17 80453916 missense probably damaging 0.99
R1635:Sos1 UTSW 17 80422679 splice site probably null
R3770:Sos1 UTSW 17 80398308 missense probably damaging 0.97
R3951:Sos1 UTSW 17 80424181 missense probably damaging 1.00
R3964:Sos1 UTSW 17 80455179 missense probably damaging 1.00
R3966:Sos1 UTSW 17 80455179 missense probably damaging 1.00
R4086:Sos1 UTSW 17 80449352 missense probably benign 0.06
R4087:Sos1 UTSW 17 80449352 missense probably benign 0.06
R4089:Sos1 UTSW 17 80449352 missense probably benign 0.06
R4194:Sos1 UTSW 17 80398584 missense probably benign 0.02
R4468:Sos1 UTSW 17 80453811 missense probably damaging 1.00
R4469:Sos1 UTSW 17 80453811 missense probably damaging 1.00
R4597:Sos1 UTSW 17 80433826 missense probably benign 0.05
R4773:Sos1 UTSW 17 80398231 missense probably damaging 0.99
R4923:Sos1 UTSW 17 80434952 missense probably benign 0.10
R5120:Sos1 UTSW 17 80408248 missense probably damaging 0.98
R5478:Sos1 UTSW 17 80433847 missense probably damaging 1.00
R5566:Sos1 UTSW 17 80453890 missense possibly damaging 0.91
R5984:Sos1 UTSW 17 80452132 missense possibly damaging 0.68
R6053:Sos1 UTSW 17 80415034 missense possibly damaging 0.94
R6153:Sos1 UTSW 17 80449335 missense probably benign 0.01
R6567:Sos1 UTSW 17 80433503 missense probably damaging 1.00
R7392:Sos1 UTSW 17 80424200 missense probably damaging 1.00
R7623:Sos1 UTSW 17 80479894 missense probably benign 0.28
R7763:Sos1 UTSW 17 80413713 missense probably benign
X0020:Sos1 UTSW 17 80449277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCTCCCAAGTTGTAGGG -3'
(R):5'- AAATCTCCTGGTGTTCGTCC -3'

Sequencing Primer
(F):5'- AACCTCCCAAGTTGTAGGGTTTAG -3'
(R):5'- GGTGTTCGTCCATCAAATCCAAG -3'
Posted On2015-02-18