Incidental Mutation 'R3413:Mmel1'
ID267796
Institutional Source Beutler Lab
Gene Symbol Mmel1
Ensembl Gene ENSMUSG00000058183
Gene Namemembrane metallo-endopeptidase-like 1
SynonymsNep2, Mell1, Nl1, NEPLP gamma, NEPLP beta, NEPLP alpha, SEP
MMRRC Submission 040631-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R3413 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location154869585-154895528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 154889586 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 361 (V361D)
Ref Sequence ENSEMBL: ENSMUSP00000131753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079269] [ENSMUST00000080559] [ENSMUST00000105634] [ENSMUST00000105635] [ENSMUST00000131758] [ENSMUST00000163732]
Predicted Effect probably damaging
Transcript: ENSMUST00000079269
AA Change: V361D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078252
Gene: ENSMUSG00000058183
AA Change: V361D

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 767 1.2e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080559
AA Change: V375D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079399
Gene: ENSMUSG00000058183
AA Change: V375D

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 512 4.8e-131 PFAM
Pfam:Peptidase_M13 573 779 3.4e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105634
AA Change: V375D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101259
Gene: ENSMUSG00000058183
AA Change: V375D

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 512 1.4e-105 PFAM
Pfam:Peptidase_M13 573 781 4e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105635
AA Change: V338D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101260
Gene: ENSMUSG00000058183
AA Change: V338D

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 475 1.6e-135 PFAM
Pfam:Peptidase_M13 536 744 1.2e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129623
Predicted Effect probably benign
Transcript: ENSMUST00000131758
SMART Domains Protein: ENSMUSP00000121243
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
Pfam:Peptidase_M13_N 8 150 2.8e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163732
AA Change: V361D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131753
Gene: ENSMUSG00000058183
AA Change: V361D

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 765 3.3e-71 PFAM
Meta Mutation Damage Score 0.8424 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the neutral endopeptidase (NEP) or membrane metallo-endopeptidase (MME) family. Family members play important roles in pain perception, arterial pressure regulation, phosphate metabolism and homeostasis. This protein is a type II transmembrane protein and is thought to be expressed as a secreted protein. This gene is expressed mainly in testis with weak expression in the brain, kidney, and heart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display impaired male fertility. Female fertility is not affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,987,387 probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Axin1 A G 17: 26,188,038 H535R probably damaging Het
Ccnb3 T A X: 7,007,801 E846D probably benign Het
Cdca7 G A 2: 72,485,287 G365R probably damaging Het
Clvs2 T A 10: 33,622,971 probably benign Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Ddx42 A G 11: 106,247,810 T812A probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
Got1l1 A G 8: 27,199,836 probably null Het
Hip1 T C 5: 135,422,172 E451G probably damaging Het
Hs6st2 C T X: 51,681,455 V50I possibly damaging Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Map1s A G 8: 70,912,519 N107D probably damaging Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nup210 G T 6: 91,025,242 Q755K probably benign Het
Olfr114 A G 17: 37,589,696 V219A probably benign Het
Olfr638 A G 7: 104,003,832 M186V probably damaging Het
Pih1h3b T A X: 140,106,021 N216K possibly damaging Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Sspo C T 6: 48,480,697 R3178C probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syk A G 13: 52,631,739 D327G probably benign Het
Tbc1d8b C T X: 139,713,391 A391V probably benign Het
Tmed9 A G 13: 55,595,574 E173G probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp92 C T X: 73,420,294 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Mmel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Mmel1 APN 4 154887832 splice site probably benign
IGL01560:Mmel1 APN 4 154892510 missense probably null 1.00
IGL01734:Mmel1 APN 4 154891951 missense probably benign 0.00
IGL02933:Mmel1 APN 4 154883630 missense probably damaging 1.00
IGL03178:Mmel1 APN 4 154890854 missense possibly damaging 0.75
R1161:Mmel1 UTSW 4 154895214 missense probably damaging 1.00
R1522:Mmel1 UTSW 4 154894986 missense probably damaging 1.00
R1566:Mmel1 UTSW 4 154883653 missense probably damaging 1.00
R1885:Mmel1 UTSW 4 154890876 missense possibly damaging 0.76
R2177:Mmel1 UTSW 4 154894103 missense probably damaging 1.00
R3432:Mmel1 UTSW 4 154885498 splice site probably benign
R3870:Mmel1 UTSW 4 154883638 missense probably benign 0.01
R4197:Mmel1 UTSW 4 154893304 missense probably damaging 1.00
R4822:Mmel1 UTSW 4 154887897 missense probably benign 0.00
R4998:Mmel1 UTSW 4 154885510 missense probably benign 0.00
R5135:Mmel1 UTSW 4 154882324 missense probably benign 0.20
R5225:Mmel1 UTSW 4 154891999 missense probably damaging 0.96
R5821:Mmel1 UTSW 4 154885587 missense possibly damaging 0.82
R6131:Mmel1 UTSW 4 154895018 missense probably damaging 1.00
R6132:Mmel1 UTSW 4 154895018 missense probably damaging 1.00
R6133:Mmel1 UTSW 4 154895018 missense probably damaging 1.00
R6194:Mmel1 UTSW 4 154883216 nonsense probably null
R6223:Mmel1 UTSW 4 154871702 splice site probably null
R6786:Mmel1 UTSW 4 154892428 nonsense probably null
R6921:Mmel1 UTSW 4 154881677 missense probably damaging 0.97
R7272:Mmel1 UTSW 4 154894090 missense probably damaging 1.00
R7373:Mmel1 UTSW 4 154889208 missense not run
R7685:Mmel1 UTSW 4 154871654 start codon destroyed probably null 0.28
R7996:Mmel1 UTSW 4 154892455 missense probably benign 0.03
X0025:Mmel1 UTSW 4 154894685 missense probably benign 0.06
Z1176:Mmel1 UTSW 4 154895208 nonsense probably null
Z1177:Mmel1 UTSW 4 154894074 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGAAATGTCACCCTTGGTCC -3'
(R):5'- TCACGCTGGAGGAAAAGTGC -3'

Sequencing Primer
(F):5'- TGGTCCTGATTCCTATTGACAG -3'
(R):5'- AAAAGTGCTGGATGGGATCTTCTCC -3'
Posted On2015-02-18