Incidental Mutation 'R3413:Gckr'
ID267797
Institutional Source Beutler Lab
Gene Symbol Gckr
Ensembl Gene ENSMUSG00000059434
Gene Nameglucokinase regulatory protein
SynonymsGKRP
MMRRC Submission 040631-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3413 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31297443-31327314 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 31300867 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041266] [ENSMUST00000072228] [ENSMUST00000072228] [ENSMUST00000072228] [ENSMUST00000072228] [ENSMUST00000072228] [ENSMUST00000072228] [ENSMUST00000172435] [ENSMUST00000201166] [ENSMUST00000201166] [ENSMUST00000201166] [ENSMUST00000201166] [ENSMUST00000201166] [ENSMUST00000201166] [ENSMUST00000201417] [ENSMUST00000201675]
Predicted Effect probably benign
Transcript: ENSMUST00000041266
SMART Domains Protein: ENSMUSP00000047185
Gene: ENSMUSG00000038552

DomainStartEndE-ValueType
FN3 43 123 4.35e-11 SMART
transmembrane domain 161 183 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000072228
SMART Domains Protein: ENSMUSP00000072084
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 584 N/A PDB
Predicted Effect probably null
Transcript: ENSMUST00000072228
SMART Domains Protein: ENSMUSP00000072084
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 584 N/A PDB
Predicted Effect probably null
Transcript: ENSMUST00000072228
SMART Domains Protein: ENSMUSP00000072084
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 584 N/A PDB
Predicted Effect probably null
Transcript: ENSMUST00000072228
SMART Domains Protein: ENSMUSP00000072084
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 584 N/A PDB
Predicted Effect probably null
Transcript: ENSMUST00000072228
SMART Domains Protein: ENSMUSP00000072084
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 584 N/A PDB
Predicted Effect probably null
Transcript: ENSMUST00000072228
SMART Domains Protein: ENSMUSP00000072084
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 584 N/A PDB
Predicted Effect probably benign
Transcript: ENSMUST00000172435
SMART Domains Protein: ENSMUSP00000127404
Gene: ENSMUSG00000038552

DomainStartEndE-ValueType
FN3 43 123 4.35e-11 SMART
transmembrane domain 161 183 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201166
SMART Domains Protein: ENSMUSP00000144202
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 620 N/A PDB
Predicted Effect probably null
Transcript: ENSMUST00000201166
SMART Domains Protein: ENSMUSP00000144202
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 620 N/A PDB
Predicted Effect probably null
Transcript: ENSMUST00000201166
SMART Domains Protein: ENSMUSP00000144202
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 620 N/A PDB
Predicted Effect probably null
Transcript: ENSMUST00000201166
SMART Domains Protein: ENSMUSP00000144202
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 620 N/A PDB
Predicted Effect probably null
Transcript: ENSMUST00000201166
SMART Domains Protein: ENSMUSP00000144202
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 620 N/A PDB
Predicted Effect probably null
Transcript: ENSMUST00000201166
SMART Domains Protein: ENSMUSP00000144202
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 620 N/A PDB
Predicted Effect probably benign
Transcript: ENSMUST00000201417
SMART Domains Protein: ENSMUSP00000144142
Gene: ENSMUSG00000038552

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
FN3 43 118 9.4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201675
SMART Domains Protein: ENSMUSP00000144568
Gene: ENSMUSG00000059434

DomainStartEndE-ValueType
PDB:4LC9|A 1 120 7e-64 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202909
Meta Mutation Damage Score 0.9477 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the GCKR subfamily of the SIS (Sugar ISomerase) family of proteins. The gene product is a regulatory protein that inhibits glucokinase in liver and pancreatic islet cells by binding non-covalently to form an inactive complex with the enzyme. This gene is considered a susceptibility gene candidate for a form of maturity-onset diabetes of the young (MODY). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced glucokinase protein levels and activity in the liver and altered glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,987,387 probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Axin1 A G 17: 26,188,038 H535R probably damaging Het
Ccnb3 T A X: 7,007,801 E846D probably benign Het
Cdca7 G A 2: 72,485,287 G365R probably damaging Het
Clvs2 T A 10: 33,622,971 probably benign Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Ddx42 A G 11: 106,247,810 T812A probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
Got1l1 A G 8: 27,199,836 probably null Het
Hip1 T C 5: 135,422,172 E451G probably damaging Het
Hs6st2 C T X: 51,681,455 V50I possibly damaging Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Map1s A G 8: 70,912,519 N107D probably damaging Het
Mmel1 T A 4: 154,889,586 V361D probably damaging Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nup210 G T 6: 91,025,242 Q755K probably benign Het
Olfr114 A G 17: 37,589,696 V219A probably benign Het
Olfr638 A G 7: 104,003,832 M186V probably damaging Het
Pih1h3b T A X: 140,106,021 N216K possibly damaging Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Sspo C T 6: 48,480,697 R3178C probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syk A G 13: 52,631,739 D327G probably benign Het
Tbc1d8b C T X: 139,713,391 A391V probably benign Het
Tmed9 A G 13: 55,595,574 E173G probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp92 C T X: 73,420,294 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Gckr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Gckr APN 5 31299576 missense probably damaging 1.00
IGL00325:Gckr APN 5 31307767 missense possibly damaging 0.92
IGL00958:Gckr APN 5 31298785 splice site probably null
IGL01102:Gckr APN 5 31309037 missense probably damaging 0.97
IGL01380:Gckr APN 5 31299633 unclassified probably benign
IGL01780:Gckr APN 5 31307790 missense possibly damaging 0.82
IGL02110:Gckr APN 5 31298738 missense possibly damaging 0.94
IGL02187:Gckr APN 5 31307424 splice site probably benign
IGL02350:Gckr APN 5 31307790 missense possibly damaging 0.82
IGL02357:Gckr APN 5 31307790 missense possibly damaging 0.82
IGL02600:Gckr APN 5 31305030 missense probably benign 0.01
IGL02616:Gckr APN 5 31327075 missense probably benign 0.07
IGL02803:Gckr APN 5 31298204 missense probably damaging 1.00
R0004:Gckr UTSW 5 31297589 unclassified probably benign
R0079:Gckr UTSW 5 31306539 missense probably benign 0.01
R0165:Gckr UTSW 5 31326948 missense possibly damaging 0.90
R0853:Gckr UTSW 5 31305048 missense probably damaging 1.00
R0964:Gckr UTSW 5 31326915 splice site probably benign
R2174:Gckr UTSW 5 31327009 missense possibly damaging 0.95
R2212:Gckr UTSW 5 31300867 critical splice donor site probably null
R2892:Gckr UTSW 5 31326472 missense probably benign 0.00
R3412:Gckr UTSW 5 31300867 critical splice donor site probably null
R3764:Gckr UTSW 5 31326498 splice site probably benign
R4608:Gckr UTSW 5 31307797 missense probably damaging 0.99
R4757:Gckr UTSW 5 31307384 missense possibly damaging 0.49
R4814:Gckr UTSW 5 31298300 nonsense probably null
R4953:Gckr UTSW 5 31308264 missense probably damaging 1.00
R5906:Gckr UTSW 5 31306578 missense probably damaging 1.00
R7030:Gckr UTSW 5 31302210 missense possibly damaging 0.89
R7665:Gckr UTSW 5 31297555
R7684:Gckr UTSW 5 31307797 missense probably damaging 1.00
R8432:Gckr UTSW 5 31309103 missense possibly damaging 0.82
Z1176:Gckr UTSW 5 31300831 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGAAGAAGGTCTGTGTCTCCTG -3'
(R):5'- ACTGCCAGAGTAGCTTGCTG -3'

Sequencing Primer
(F):5'- ACCTGGAGATGCCCATATATTC -3'
(R):5'- CAGAGTAGCTTGCTGACTCCTG -3'
Posted On2015-02-18