Mutagenetix > Incidental Mutation

Incidental Mutation 'R3413:Ppef2'

267799

Institutional Source

Beutler Lab

Gene Symbol

Ppef2

Ensembl Gene

ENSMUSG00000029410

Gene Name

protein phosphatase, EF hand calcium-binding domain 2

Synonyms

MMRRC Submission

040631-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3413 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92226679-92256278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 92228722 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 649 (S649R)

Ref Sequence

ENSEMBL: ENSMUSP00000144157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031359] [ENSMUST00000201130]

AlphaFold

O35385

Predicted Effect

probably damaging
Transcript: ENSMUST00000031359
AA Change: S649R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000031359
Gene: ENSMUSG00000029410
AA Change: S649R

Domain	Start	End	E-Value	Type
IQ	18	40	3.48e-1	SMART
PP2Ac	141	544	1.97e-118	SMART
EFh	576	604	3.25e1	SMART
EFh	660	688	5.44e-3	SMART
EFh	700	728	1.67e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000201130
AA Change: S649R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000144157
Gene: ENSMUSG00000029410
AA Change: S649R

Domain	Start	End	E-Value	Type
IQ	18	40	3.48e-1	SMART
PP2Ac	141	544	1.97e-118	SMART
EFh	576	604	3.25e1	SMART
EFh	660	688	5.44e-3	SMART
EFh	700	728	1.67e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201236

Meta Mutation Damage Score

0.0887

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein phosphatase with EF-hand motif family. The protein contains a protein phosphatase catalytic domain, and at least two EF-hand calcium-binding motifs in its C terminus. Although its substrate(s) is unknown, the encoded protein, which is expressed specifically in photoreceptors and the pineal, has been suggested to play a role in the visual system. This gene shares high sequence similarity with the Drosophila retinal degeneration C (rdgC) gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation appear to be phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd13	T	C	8: 9,987,387		probably benign	Het
Ap2a2	T	A	7: 141,598,776	N105K	probably benign	Het
Axin1	A	G	17: 26,188,038	H535R	probably damaging	Het
Ccnb3	T	A	X: 7,007,801	E846D	probably benign	Het
Cdca7	G	A	2: 72,485,287	G365R	probably damaging	Het
Clvs2	T	A	10: 33,622,971		probably benign	Het
Coq10a	A	G	10: 128,365,129	V93A	possibly damaging	Het
Ddx42	A	G	11: 106,247,810	T812A	probably benign	Het
Eya1	T	A	1: 14,274,209		probably null	Het
Fcna	G	C	2: 25,627,493	P49A	probably damaging	Het
Gckr	T	A	5: 31,300,867		probably null	Het
Golgb1	A	G	16: 36,887,347	K68E	probably damaging	Het
Got1l1	A	G	8: 27,199,836		probably null	Het
Hip1	T	C	5: 135,422,172	E451G	probably damaging	Het
Hs6st2	C	T	X: 51,681,455	V50I	possibly damaging	Het
Ighv1-23	C	T	12: 114,764,467	V112I	probably benign	Het
Map1s	A	G	8: 70,912,519	N107D	probably damaging	Het
Mmel1	T	A	4: 154,889,586	V361D	probably damaging	Het
Myh15	A	G	16: 49,138,732	D989G	probably benign	Het
Myo1g	G	T	11: 6,517,870	H188Q	possibly damaging	Het
Nup210	G	T	6: 91,025,242	Q755K	probably benign	Het
Olfr114	A	G	17: 37,589,696	V219A	probably benign	Het
Olfr638	A	G	7: 104,003,832	M186V	probably damaging	Het
Pih1h3b	T	A	X: 140,106,021	N216K	possibly damaging	Het
Plcz1	C	T	6: 140,002,081	R525Q	probably damaging	Het
Rusc2	T	G	4: 43,415,935	S414A	probably damaging	Het
Sez6l	A	G	5: 112,475,361	L108P	possibly damaging	Het
Slc1a7	A	G	4: 108,010,994	E497G	probably benign	Het
Spag8	T	A	4: 43,651,606	S423C	probably damaging	Het
Sspo	C	T	6: 48,480,697	R3178C	probably damaging	Het
St6galnac1	A	G	11: 116,765,856	W486R	probably damaging	Het
Syk	A	G	13: 52,631,739	D327G	probably benign	Het
Tbc1d8b	C	T	X: 139,713,391	A391V	probably benign	Het
Tmed9	A	G	13: 55,595,574	E173G	probably benign	Het
Top1mt	T	C	15: 75,657,176	N573S	probably benign	Het
Tusc1	C	A	4: 93,334,936	R162L	probably damaging	Het
Ubn2	A	G	6: 38,498,739	T1211A	probably benign	Het
Unc80	G	A	1: 66,639,305	V2082I	probably benign	Het
Vmn2r63	A	G	7: 42,926,982	F469S	probably benign	Het
Zfp92	C	T	X: 73,420,294		probably benign	Het
Zfyve28	C	T	5: 34,199,684	M723I	probably benign	Het
Zmynd8	A	T	2: 165,815,451	M533K	probably damaging	Het

Other mutations in Ppef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01066:Ppef2	APN	5	92234237	missense	probably damaging	1.00
IGL01105:Ppef2	APN	5	92249196	missense	possibly damaging	0.91
IGL01613:Ppef2	APN	5	92235820	missense	probably benign	0.01
IGL01793:Ppef2	APN	5	92246756	missense	probably damaging	1.00
IGL02529:Ppef2	APN	5	92244737	missense	probably damaging	1.00
IGL02702:Ppef2	APN	5	92231819	missense	probably benign	0.01
IGL02992:Ppef2	APN	5	92235900	nonsense	probably null
IGL02995:Ppef2	APN	5	92235900	nonsense	probably null
IGL02996:Ppef2	APN	5	92235900	nonsense	probably null
IGL03169:Ppef2	APN	5	92235900	nonsense	probably null
IGL02991:Ppef2	UTSW	5	92235900	nonsense	probably null
R0494:Ppef2	UTSW	5	92253093	splice site	probably benign
R0659:Ppef2	UTSW	5	92230509	missense	probably damaging	1.00
R0781:Ppef2	UTSW	5	92244830	missense	probably benign	0.39
R1162:Ppef2	UTSW	5	92253121	missense	probably benign	0.00
R1870:Ppef2	UTSW	5	92250512	missense	probably damaging	1.00
R2212:Ppef2	UTSW	5	92228722	missense	probably damaging	0.97
R2973:Ppef2	UTSW	5	92239094	missense	probably benign
R3412:Ppef2	UTSW	5	92228722	missense	probably damaging	0.97
R3745:Ppef2	UTSW	5	92239151	splice site	probably benign
R4878:Ppef2	UTSW	5	92228740	splice site	probably null
R5027:Ppef2	UTSW	5	92234291	missense	probably damaging	1.00
R5156:Ppef2	UTSW	5	92244602	critical splice donor site	probably null
R5316:Ppef2	UTSW	5	92235811	missense	probably benign	0.00
R5590:Ppef2	UTSW	5	92239139	missense	probably damaging	0.99
R5773:Ppef2	UTSW	5	92250561	missense	probably damaging	1.00
R5881:Ppef2	UTSW	5	92250529	nonsense	probably null
R6032:Ppef2	UTSW	5	92230524	missense	probably benign	0.23
R6032:Ppef2	UTSW	5	92230524	missense	probably benign	0.23
R6182:Ppef2	UTSW	5	92227066	missense	probably damaging	1.00
R6335:Ppef2	UTSW	5	92235754	missense	probably damaging	1.00
R6645:Ppef2	UTSW	5	92230461	missense	probably benign	0.02
R7448:Ppef2	UTSW	5	92228704	missense	probably damaging	1.00
R7576:Ppef2	UTSW	5	92253134	missense	possibly damaging	0.87
R7968:Ppef2	UTSW	5	92249163	missense	probably damaging	0.99
R7988:Ppef2	UTSW	5	92238982	missense	probably benign	0.00
R8200:Ppef2	UTSW	5	92245392	missense	probably benign	0.13
R8212:Ppef2	UTSW	5	92228665	missense	possibly damaging	0.87
R9687:Ppef2	UTSW	5	92238887	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGACAACTCAACAGCTGCGTG -3'
(R):5'- ATGCGAACATCAGCATTGC -3'

Sequencing Primer
(F):5'- TCAACAGCTGCGTGCAACTTG -3'
(R):5'- GAGTTCACTGGCCCCAA -3'

Posted On

2015-02-18