Mutagenetix > Incidental Mutations

Incidental Mutation 'R3413:Hip1'

List |< first << previous [record 14 of 43] next >> last >|

267801

Institutional Source

Beutler Lab

Gene Symbol

Hip1

Ensembl Gene

ENSMUSG00000039959

Gene Name

huntingtin interacting protein 1

Synonyms

HIP-1, 2610109B09Rik, A930014B11Rik, E130315I21Rik

MMRRC Submission

040631-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.854) question?

Stock #

R3413 (G1)

Quality Score

204

Status

Validated

Chromosome

Chromosomal Location

135406531-135545120 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135422172 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 451 (E451G)

Ref Sequence

ENSEMBL: ENSMUSP00000144086 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060311] [ENSMUST00000202643]

Predicted Effect

probably damaging
Transcript: ENSMUST00000060311
AA Change: E862G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000059033
Gene: ENSMUSG00000039959
AA Change: E862G

Domain	Start	End	E-Value	Type
ENTH	38	160	9.98e-41	SMART
PDB:3I00\|B	361	480	9e-57	PDB
Pfam:HIP1_clath_bdg	482	572	2.1e-27	PFAM
low complexity region	649	658	N/A	INTRINSIC
low complexity region	780	796	N/A	INTRINSIC
ILWEQ	806	1004	9.05e-120	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000202643
AA Change: E451G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144086
Gene: ENSMUSG00000039959
AA Change: E451G

Domain	Start	End	E-Value	Type
PDB:2QA7\|D	1	70	9e-34	PDB
Pfam:HIP1_clath_bdg	71	161	4.4e-24	PFAM
low complexity region	238	247	N/A	INTRINSIC
low complexity region	369	385	N/A	INTRINSIC
ILWEQ	395	593	5.7e-122	SMART

Meta Mutation Damage Score

0.7026

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that functions in clathrin-mediated endocytosis and protein trafficking within the cell. The encoded protein binds to the huntingtin protein in the brain; this interaction is lost in Huntington's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutants may exhibit axial skeleton defects, hematopotietic abnormalities, and testicular degeneration with increased apoptosis of postmeiotic spermatids. One line showed microphthalmia and cataracts, whereas others did not. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd13	T	C	8: 9,987,387		probably benign	Het
Ap2a2	T	A	7: 141,598,776	N105K	probably benign	Het
Axin1	A	G	17: 26,188,038	H535R	probably damaging	Het
Ccnb3	T	A	X: 7,007,801	E846D	probably benign	Het
Cdca7	G	A	2: 72,485,287	G365R	probably damaging	Het
Clvs2	T	A	10: 33,622,971		probably benign	Het
Coq10a	A	G	10: 128,365,129	V93A	possibly damaging	Het
Ddx42	A	G	11: 106,247,810	T812A	probably benign	Het
Eya1	T	A	1: 14,274,209		probably null	Het
Fcna	G	C	2: 25,627,493	P49A	probably damaging	Het
Gckr	T	A	5: 31,300,867		probably null	Het
Golgb1	A	G	16: 36,887,347	K68E	probably damaging	Het
Got1l1	A	G	8: 27,199,836		probably null	Het
Hs6st2	C	T	X: 51,681,455	V50I	possibly damaging	Het
Ighv1-23	C	T	12: 114,764,467	V112I	probably benign	Het
Map1s	A	G	8: 70,912,519	N107D	probably damaging	Het
Mmel1	T	A	4: 154,889,586	V361D	probably damaging	Het
Myh15	A	G	16: 49,138,732	D989G	probably benign	Het
Myo1g	G	T	11: 6,517,870	H188Q	possibly damaging	Het
Nup210	G	T	6: 91,025,242	Q755K	probably benign	Het
Olfr114	A	G	17: 37,589,696	V219A	probably benign	Het
Olfr638	A	G	7: 104,003,832	M186V	probably damaging	Het
Pih1h3b	T	A	X: 140,106,021	N216K	possibly damaging	Het
Plcz1	C	T	6: 140,002,081	R525Q	probably damaging	Het
Ppef2	T	G	5: 92,228,722	S649R	probably damaging	Het
Rusc2	T	G	4: 43,415,935	S414A	probably damaging	Het
Sez6l	A	G	5: 112,475,361	L108P	possibly damaging	Het
Slc1a7	A	G	4: 108,010,994	E497G	probably benign	Het
Spag8	T	A	4: 43,651,606	S423C	probably damaging	Het
Sspo	C	T	6: 48,480,697	R3178C	probably damaging	Het
St6galnac1	A	G	11: 116,765,856	W486R	probably damaging	Het
Syk	A	G	13: 52,631,739	D327G	probably benign	Het
Tbc1d8b	C	T	X: 139,713,391	A391V	probably benign	Het
Tmed9	A	G	13: 55,595,574	E173G	probably benign	Het
Top1mt	T	C	15: 75,657,176	N573S	probably benign	Het
Tusc1	C	A	4: 93,334,936	R162L	probably damaging	Het
Ubn2	A	G	6: 38,498,739	T1211A	probably benign	Het
Unc80	G	A	1: 66,639,305	V2082I	probably benign	Het
Vmn2r63	A	G	7: 42,926,982	F469S	probably benign	Het
Zfp92	C	T	X: 73,420,294		probably benign	Het
Zfyve28	C	T	5: 34,199,684	M723I	probably benign	Het
Zmynd8	A	T	2: 165,815,451	M533K	probably damaging	Het

Other mutations in Hip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Hip1	APN	5	135449822	missense	probably damaging	1.00
IGL00418:Hip1	APN	5	135426346	missense	probably damaging	1.00
IGL01744:Hip1	APN	5	135545063	utr 5 prime	probably benign
IGL02494:Hip1	APN	5	135444791	nonsense	probably null
IGL02749:Hip1	APN	5	135444751	missense	probably benign	0.00
IGL03219:Hip1	APN	5	135457050	missense	probably benign	0.16
IGL03328:Hip1	APN	5	135424874	missense	probably damaging	1.00
BB010:Hip1	UTSW	5	135460456	missense	probably damaging	0.98
BB020:Hip1	UTSW	5	135460456	missense	probably damaging	0.98
R0100:Hip1	UTSW	5	135436453	missense	probably benign
R0100:Hip1	UTSW	5	135436453	missense	probably benign
R0336:Hip1	UTSW	5	135428613	missense	probably benign	0.39
R0410:Hip1	UTSW	5	135458155	missense	probably damaging	1.00
R1454:Hip1	UTSW	5	135438632	missense	probably benign
R1530:Hip1	UTSW	5	135444780	missense	probably damaging	1.00
R1848:Hip1	UTSW	5	135435141	splice site	probably null
R2201:Hip1	UTSW	5	135431730	missense	probably benign
R2246:Hip1	UTSW	5	135452844	missense	probably damaging	1.00
R2276:Hip1	UTSW	5	135457046	missense	probably damaging	1.00
R2353:Hip1	UTSW	5	135412712	missense	probably damaging	1.00
R3013:Hip1	UTSW	5	135435039	missense	possibly damaging	0.91
R3939:Hip1	UTSW	5	135428764	missense	probably benign	0.14
R4153:Hip1	UTSW	5	135412706	missense	probably damaging	1.00
R4839:Hip1	UTSW	5	135426318	splice site	probably null
R5059:Hip1	UTSW	5	135449821	missense	probably damaging	1.00
R5171:Hip1	UTSW	5	135440302	missense	probably damaging	1.00
R5189:Hip1	UTSW	5	135434293	missense	probably damaging	1.00
R5358:Hip1	UTSW	5	135436398	missense	probably benign	0.22
R5642:Hip1	UTSW	5	135433085	nonsense	probably null
R5646:Hip1	UTSW	5	135428741	missense	probably damaging	0.98
R5831:Hip1	UTSW	5	135411263	missense	probably benign	0.00
R5908:Hip1	UTSW	5	135424863	critical splice donor site	probably null
R6484:Hip1	UTSW	5	135440129	missense	probably damaging	1.00
R6535:Hip1	UTSW	5	135428497	splice site	probably null
R6557:Hip1	UTSW	5	135428719	missense	possibly damaging	0.67
R7459:Hip1	UTSW	5	135414297	missense	probably damaging	1.00
R7589:Hip1	UTSW	5	135414311	missense	probably benign
R7677:Hip1	UTSW	5	135430317	missense	probably benign
R7933:Hip1	UTSW	5	135460456	missense	probably damaging	0.98
R8267:Hip1	UTSW	5	135428613	missense	probably benign	0.39
Z1177:Hip1	UTSW	5	135428606	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGATCTAGCCCAGCACACTC -3'
(R):5'- CTCTGAATTTAAGGCCAGTCTGG -3'

Sequencing Primer
(F):5'- TTATTACACAAGGACCTGGGTAGCC -3'
(R):5'- GTCTACAGAGTGCGTTCCAG -3'

Posted On

2015-02-18