Incidental Mutation 'R3413:Plcz1'
ID267805
Institutional Source Beutler Lab
Gene Symbol Plcz1
Ensembl Gene ENSMUSG00000030230
Gene Namephospholipase C, zeta 1
Synonyms1700041H07Rik
MMRRC Submission 040631-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3413 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location139989673-140041457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 140002081 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 525 (R525Q)
Ref Sequence ENSEMBL: ENSMUSP00000032356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032356] [ENSMUST00000129986] [ENSMUST00000137148]
Predicted Effect probably damaging
Transcript: ENSMUST00000032356
AA Change: R525Q

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032356
Gene: ENSMUSG00000030230
AA Change: R525Q

DomainStartEndE-ValueType
Pfam:EF-hand_like 80 162 9.6e-26 PFAM
PLCXc 163 307 5.17e-72 SMART
low complexity region 374 385 N/A INTRINSIC
PLCYc 386 502 1.52e-51 SMART
C2 521 625 2.06e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129986
Predicted Effect probably benign
Transcript: ENSMUST00000137148
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the phosphoinositide-specific phospholipase C family. Members in this family, classified into six isotypes that are tissue- and organ-specific, hydrolyze phosphatidylinositol 4,5-bisphosphate just before the phosphate group to yield diacylglycerol and inositol 1,4,5-trisphosphate. This protein localizes to the acrosome in spermatozoa and elicits Ca(2+) oscillations and egg activation during fertilization that leads to early embryonic development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous knockout mice display normal spermatogenesis and sperm motility but are sub-fertile because of a failure to induce Ca2+ oscillations in oocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,987,387 probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Axin1 A G 17: 26,188,038 H535R probably damaging Het
Ccnb3 T A X: 7,007,801 E846D probably benign Het
Cdca7 G A 2: 72,485,287 G365R probably damaging Het
Clvs2 T A 10: 33,622,971 probably benign Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Ddx42 A G 11: 106,247,810 T812A probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
Got1l1 A G 8: 27,199,836 probably null Het
Hip1 T C 5: 135,422,172 E451G probably damaging Het
Hs6st2 C T X: 51,681,455 V50I possibly damaging Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Map1s A G 8: 70,912,519 N107D probably damaging Het
Mmel1 T A 4: 154,889,586 V361D probably damaging Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nup210 G T 6: 91,025,242 Q755K probably benign Het
Olfr114 A G 17: 37,589,696 V219A probably benign Het
Olfr638 A G 7: 104,003,832 M186V probably damaging Het
Pih1h3b T A X: 140,106,021 N216K possibly damaging Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Sspo C T 6: 48,480,697 R3178C probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syk A G 13: 52,631,739 D327G probably benign Het
Tbc1d8b C T X: 139,713,391 A391V probably benign Het
Tmed9 A G 13: 55,595,574 E173G probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp92 C T X: 73,420,294 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Plcz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Plcz1 APN 6 140002256 splice site probably benign
IGL01825:Plcz1 APN 6 140003916 missense probably benign 0.03
IGL01885:Plcz1 APN 6 140002111 missense probably benign 0.14
IGL02539:Plcz1 APN 6 139992964 missense probably benign 0.06
IGL02754:Plcz1 APN 6 140010581 missense probably benign 0.00
IGL03379:Plcz1 APN 6 139990764 missense possibly damaging 0.69
IGL03412:Plcz1 APN 6 140016097 missense probably damaging 0.99
R0005:Plcz1 UTSW 6 140040564 splice site probably benign
R0034:Plcz1 UTSW 6 140020448 utr 3 prime probably benign
R0078:Plcz1 UTSW 6 139989784 missense probably damaging 1.00
R0142:Plcz1 UTSW 6 140007697 missense probably damaging 1.00
R0200:Plcz1 UTSW 6 139990733 missense probably damaging 1.00
R0399:Plcz1 UTSW 6 140023230 missense possibly damaging 0.95
R0599:Plcz1 UTSW 6 140028542 missense probably benign
R0608:Plcz1 UTSW 6 139990733 missense probably damaging 1.00
R1854:Plcz1 UTSW 6 139993049 missense probably benign 0.36
R2212:Plcz1 UTSW 6 140002081 missense probably damaging 0.98
R2895:Plcz1 UTSW 6 140023151 missense possibly damaging 0.79
R4239:Plcz1 UTSW 6 140040618 unclassified probably null
R4441:Plcz1 UTSW 6 139990687 missense probably benign 0.00
R4889:Plcz1 UTSW 6 140007748 missense probably benign 0.00
R4953:Plcz1 UTSW 6 140028551 missense possibly damaging 0.89
R5175:Plcz1 UTSW 6 140039663 missense possibly damaging 0.94
R5359:Plcz1 UTSW 6 140028452 missense probably damaging 1.00
R5401:Plcz1 UTSW 6 139993052 splice site probably null
R5505:Plcz1 UTSW 6 140016216 missense probably damaging 0.99
R5558:Plcz1 UTSW 6 140039755 missense probably damaging 1.00
R5581:Plcz1 UTSW 6 140023125 missense probably damaging 1.00
R6252:Plcz1 UTSW 6 140007603 critical splice donor site probably null
R6569:Plcz1 UTSW 6 140007707 missense possibly damaging 0.62
R6750:Plcz1 UTSW 6 140028438 missense possibly damaging 0.74
R7073:Plcz1 UTSW 6 140023123 nonsense probably null
R7204:Plcz1 UTSW 6 140010424 missense probably benign 0.05
R7309:Plcz1 UTSW 6 140023156 missense probably damaging 1.00
R7446:Plcz1 UTSW 6 140013586 missense possibly damaging 0.63
R7503:Plcz1 UTSW 6 139990748 missense probably damaging 1.00
R7634:Plcz1 UTSW 6 140016127 missense probably damaging 1.00
Z1176:Plcz1 UTSW 6 140013676 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AGTGTCATGTCTTCAAGGTCATCAG -3'
(R):5'- GCCTTGAACTTTCAAACCCCTG -3'

Sequencing Primer
(F):5'- CTCCATCACGATGCTAAATGGTG -3'
(R):5'- CTGGACTGCCTATGGATTTGCAAAAC -3'
Posted On2015-02-18