Incidental Mutation 'R3413:Vmn2r63'
ID267806
Institutional Source Beutler Lab
Gene Symbol Vmn2r63
Ensembl Gene ENSMUSG00000090751
Gene Namevomeronasal 2, receptor 63
SynonymsEG435975
MMRRC Submission 040631-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R3413 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location42903251-42933789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42926982 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 469 (F469S)
Ref Sequence ENSEMBL: ENSMUSP00000129089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163803]
Predicted Effect probably benign
Transcript: ENSMUST00000163803
AA Change: F469S

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000129089
Gene: ENSMUSG00000090751
AA Change: F469S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 3.5e-43 PFAM
Pfam:NCD3G 514 567 5.1e-23 PFAM
Pfam:7tm_3 600 835 3.5e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,987,387 probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Axin1 A G 17: 26,188,038 H535R probably damaging Het
Ccnb3 T A X: 7,007,801 E846D probably benign Het
Cdca7 G A 2: 72,485,287 G365R probably damaging Het
Clvs2 T A 10: 33,622,971 probably benign Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Ddx42 A G 11: 106,247,810 T812A probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
Got1l1 A G 8: 27,199,836 probably null Het
Hip1 T C 5: 135,422,172 E451G probably damaging Het
Hs6st2 C T X: 51,681,455 V50I possibly damaging Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Map1s A G 8: 70,912,519 N107D probably damaging Het
Mmel1 T A 4: 154,889,586 V361D probably damaging Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nup210 G T 6: 91,025,242 Q755K probably benign Het
Olfr114 A G 17: 37,589,696 V219A probably benign Het
Olfr638 A G 7: 104,003,832 M186V probably damaging Het
Pih1h3b T A X: 140,106,021 N216K possibly damaging Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Sspo C T 6: 48,480,697 R3178C probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syk A G 13: 52,631,739 D327G probably benign Het
Tbc1d8b C T X: 139,713,391 A391V probably benign Het
Tmed9 A G 13: 55,595,574 E173G probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Zfp92 C T X: 73,420,294 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Vmn2r63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Vmn2r63 APN 7 42904119 missense probably damaging 0.99
IGL01765:Vmn2r63 APN 7 42903364 missense probably benign
IGL02203:Vmn2r63 APN 7 42904008 missense probably benign 0.01
IGL02825:Vmn2r63 APN 7 42926850 critical splice donor site probably null
IGL03155:Vmn2r63 APN 7 42903454 missense probably damaging 1.00
IGL03260:Vmn2r63 APN 7 42929192 missense probably damaging 1.00
IGL03411:Vmn2r63 APN 7 42927944 missense probably benign 0.42
PIT4280001:Vmn2r63 UTSW 7 42903985 missense probably damaging 1.00
R0066:Vmn2r63 UTSW 7 42927090 splice site probably benign
R0328:Vmn2r63 UTSW 7 42903275 missense probably benign 0.09
R0344:Vmn2r63 UTSW 7 42903618 missense probably damaging 0.98
R0554:Vmn2r63 UTSW 7 42933705 nonsense probably null
R0555:Vmn2r63 UTSW 7 42928528 nonsense probably null
R0685:Vmn2r63 UTSW 7 42928010 missense probably benign 0.13
R0751:Vmn2r63 UTSW 7 42928035 missense probably damaging 1.00
R1349:Vmn2r63 UTSW 7 42929218 missense possibly damaging 0.95
R1372:Vmn2r63 UTSW 7 42929218 missense possibly damaging 0.95
R1416:Vmn2r63 UTSW 7 42927915 missense probably benign 0.00
R1502:Vmn2r63 UTSW 7 42928591 missense possibly damaging 0.62
R1563:Vmn2r63 UTSW 7 42904126 missense probably benign 0.00
R1652:Vmn2r63 UTSW 7 42928211 missense probably benign 0.32
R1693:Vmn2r63 UTSW 7 42928319 missense probably benign
R1698:Vmn2r63 UTSW 7 42933614 missense probably benign
R1753:Vmn2r63 UTSW 7 42928245 nonsense probably null
R2136:Vmn2r63 UTSW 7 42926873 missense probably damaging 0.99
R2175:Vmn2r63 UTSW 7 42933580 critical splice donor site probably null
R2261:Vmn2r63 UTSW 7 42928607 missense probably benign 0.02
R2262:Vmn2r63 UTSW 7 42928607 missense probably benign 0.02
R2263:Vmn2r63 UTSW 7 42928607 missense probably benign 0.02
R3426:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R3427:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R3802:Vmn2r63 UTSW 7 42903405 missense probably damaging 0.99
R4319:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R4321:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R4323:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R4346:Vmn2r63 UTSW 7 42928113 missense possibly damaging 0.67
R4568:Vmn2r63 UTSW 7 42933826 splice site probably null
R4649:Vmn2r63 UTSW 7 42903690 missense possibly damaging 0.79
R4653:Vmn2r63 UTSW 7 42903690 missense possibly damaging 0.79
R4679:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4734:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4741:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4748:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4806:Vmn2r63 UTSW 7 42926890 missense probably benign 0.34
R4933:Vmn2r63 UTSW 7 42903978 missense probably damaging 1.00
R5198:Vmn2r63 UTSW 7 42903745 missense probably benign 0.01
R5399:Vmn2r63 UTSW 7 42928277 missense probably benign
R5400:Vmn2r63 UTSW 7 42928211 missense probably benign 0.32
R6158:Vmn2r63 UTSW 7 42933680 missense probably damaging 1.00
R6185:Vmn2r63 UTSW 7 42929011 missense probably damaging 0.98
R6267:Vmn2r63 UTSW 7 42928635 splice site probably null
R6362:Vmn2r63 UTSW 7 42903297 missense probably benign
R6706:Vmn2r63 UTSW 7 42928577 missense probably damaging 1.00
R6764:Vmn2r63 UTSW 7 42903271 missense probably damaging 0.97
R7104:Vmn2r63 UTSW 7 42928535 missense possibly damaging 0.67
R7503:Vmn2r63 UTSW 7 42933590 missense probably benign 0.02
R7506:Vmn2r63 UTSW 7 42926967 missense probably damaging 1.00
R7525:Vmn2r63 UTSW 7 42926982 missense possibly damaging 0.52
R7658:Vmn2r63 UTSW 7 42925269 missense probably damaging 1.00
R7663:Vmn2r63 UTSW 7 42927042 missense probably benign 0.00
R7702:Vmn2r63 UTSW 7 42928129 missense possibly damaging 0.46
R7918:Vmn2r63 UTSW 7 42903531 missense probably damaging 1.00
Z1088:Vmn2r63 UTSW 7 42928559 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGTGTCCAATTAACACCATATCCTG -3'
(R):5'- GCTTTTCATCATGAGGGGATAAAAG -3'

Sequencing Primer
(F):5'- GTGTCGGCCATTGTATCA -3'
(R):5'- TCATCATGAGGGGATAAAAGACACTG -3'
Posted On2015-02-18