Mutagenetix > Incidental Mutations

Incidental Mutation 'R3413:Ap2a2'

List |< first << previous [record 2 of 43] next >> last >|

267808

Institutional Source

Beutler Lab

Gene Symbol

Ap2a2

Ensembl Gene

ENSMUSG00000002957

Gene Name

adaptor-related protein complex 2, alpha 2 subunit

Synonyms

alpha-C adaptin, alpha-adaptin C, 2410074K14Rik, Adtab, L25

MMRRC Submission

040631-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.310) question?

Stock #

R3413 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141562173-141633011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 141598776 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 105 (N105K)

Ref Sequence

ENSEMBL: ENSMUSP00000144090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003038] [ENSMUST00000201261]

Predicted Effect

probably benign
Transcript: ENSMUST00000003038
AA Change: N118K

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000003038
Gene: ENSMUSG00000002957
AA Change: N118K

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	29	590	1.7e-147	PFAM
low complexity region	646	659	N/A	INTRINSIC
low complexity region	661	684	N/A	INTRINSIC
Alpha_adaptinC2	706	819	1.45e-26	SMART
Pfam:Alpha_adaptin_C	825	933	2.8e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201261
AA Change: N105K

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000144090
Gene: ENSMUSG00000002957
AA Change: N105K

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	16	131	9.9e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201320

Meta Mutation Damage Score

0.2400

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP-2 adaptor protein complex, which is involved in linking lipid and protein membrane components with the clathrin lattice. This interaction supports the formation of clathrin-coated vesicles, and the encoded subunit aids in the process by binding polyphosphoinositide-containing lipids in the cell membrane. [provided by RefSeq, Nov 2016]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd13	T	C	8: 9,987,387		probably benign	Het
Axin1	A	G	17: 26,188,038	H535R	probably damaging	Het
Ccnb3	T	A	X: 7,007,801	E846D	probably benign	Het
Cdca7	G	A	2: 72,485,287	G365R	probably damaging	Het
Clvs2	T	A	10: 33,622,971		probably benign	Het
Coq10a	A	G	10: 128,365,129	V93A	possibly damaging	Het
Ddx42	A	G	11: 106,247,810	T812A	probably benign	Het
Eya1	T	A	1: 14,274,209		probably null	Het
Fcna	G	C	2: 25,627,493	P49A	probably damaging	Het
Gckr	T	A	5: 31,300,867		probably null	Het
Golgb1	A	G	16: 36,887,347	K68E	probably damaging	Het
Got1l1	A	G	8: 27,199,836		probably null	Het
Hip1	T	C	5: 135,422,172	E451G	probably damaging	Het
Hs6st2	C	T	X: 51,681,455	V50I	possibly damaging	Het
Ighv1-23	C	T	12: 114,764,467	V112I	probably benign	Het
Map1s	A	G	8: 70,912,519	N107D	probably damaging	Het
Mmel1	T	A	4: 154,889,586	V361D	probably damaging	Het
Myh15	A	G	16: 49,138,732	D989G	probably benign	Het
Myo1g	G	T	11: 6,517,870	H188Q	possibly damaging	Het
Nup210	G	T	6: 91,025,242	Q755K	probably benign	Het
Olfr114	A	G	17: 37,589,696	V219A	probably benign	Het
Olfr638	A	G	7: 104,003,832	M186V	probably damaging	Het
Pih1h3b	T	A	X: 140,106,021	N216K	possibly damaging	Het
Plcz1	C	T	6: 140,002,081	R525Q	probably damaging	Het
Ppef2	T	G	5: 92,228,722	S649R	probably damaging	Het
Rusc2	T	G	4: 43,415,935	S414A	probably damaging	Het
Sez6l	A	G	5: 112,475,361	L108P	possibly damaging	Het
Slc1a7	A	G	4: 108,010,994	E497G	probably benign	Het
Spag8	T	A	4: 43,651,606	S423C	probably damaging	Het
Sspo	C	T	6: 48,480,697	R3178C	probably damaging	Het
St6galnac1	A	G	11: 116,765,856	W486R	probably damaging	Het
Syk	A	G	13: 52,631,739	D327G	probably benign	Het
Tbc1d8b	C	T	X: 139,713,391	A391V	probably benign	Het
Tmed9	A	G	13: 55,595,574	E173G	probably benign	Het
Top1mt	T	C	15: 75,657,176	N573S	probably benign	Het
Tusc1	C	A	4: 93,334,936	R162L	probably damaging	Het
Ubn2	A	G	6: 38,498,739	T1211A	probably benign	Het
Unc80	G	A	1: 66,639,305	V2082I	probably benign	Het
Vmn2r63	A	G	7: 42,926,982	F469S	probably benign	Het
Zfp92	C	T	X: 73,420,294		probably benign	Het
Zfyve28	C	T	5: 34,199,684	M723I	probably benign	Het
Zmynd8	A	T	2: 165,815,451	M533K	probably damaging	Het

Other mutations in Ap2a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01112:Ap2a2	APN	7	141605019	splice site	probably benign
IGL02664:Ap2a2	APN	7	141629223	missense	probably benign	0.00
IGL02973:Ap2a2	APN	7	141631364	missense	possibly damaging	0.63
IGL03366:Ap2a2	APN	7	141629273	missense	probably benign
R0345:Ap2a2	UTSW	7	141631293	missense	probably damaging	1.00
R2212:Ap2a2	UTSW	7	141598776	missense	probably benign	0.05
R2904:Ap2a2	UTSW	7	141619478	missense	probably damaging	0.98
R3412:Ap2a2	UTSW	7	141598776	missense	probably benign	0.05
R4962:Ap2a2	UTSW	7	141630148	missense	probably damaging	1.00
R5602:Ap2a2	UTSW	7	141604942	missense	probably benign
R5910:Ap2a2	UTSW	7	141598778	missense	probably damaging	1.00
R6488:Ap2a2	UTSW	7	141602307	missense	probably benign	0.02
R7003:Ap2a2	UTSW	7	141629196	missense	probably benign
R7132:Ap2a2	UTSW	7	141619565	missense	probably benign	0.32
R7140:Ap2a2	UTSW	7	141598864	missense	probably benign	0.30
R7227:Ap2a2	UTSW	7	141620871	missense	probably damaging	1.00
R7412:Ap2a2	UTSW	7	141626136	missense	probably damaging	0.97
R7482:Ap2a2	UTSW	7	141602297	missense	possibly damaging	0.46
R7632:Ap2a2	UTSW	7	141631323	missense	probably benign	0.00
R7991:Ap2a2	UTSW	7	141609847	missense	probably damaging	1.00
R8124:Ap2a2	UTSW	7	141598844	missense	probably benign	0.05
R8271:Ap2a2	UTSW	7	141620899	missense	probably damaging	1.00
R8308:Ap2a2	UTSW	7	141630299	missense	probably benign
R8462:Ap2a2	UTSW	7	141630481	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GTGCTGATCACTGGTACATGTC -3'
(R):5'- TCCCTCACTACACACAGTGG -3'

Sequencing Primer
(F):5'- ACTGGTACATGTCCGCGTC -3'
(R):5'- GAGTGTGTTTAGAAGAAGTGCATGC -3'

Posted On

2015-02-18