Incidental Mutation 'R3413:Clvs2'
ID267812
Institutional Source Beutler Lab
Gene Symbol Clvs2
Ensembl Gene ENSMUSG00000019785
Gene Nameclavesin 2
SynonymsRlbp1l2, A330019N05Rik
MMRRC Submission 040631-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R3413 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location33512286-33624769 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to A at 33622971 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019920] [ENSMUST00000160299] [ENSMUST00000161692]
Predicted Effect probably benign
Transcript: ENSMUST00000019920
SMART Domains Protein: ENSMUSP00000019920
Gene: ENSMUSG00000019785

DomainStartEndE-ValueType
CRAL_TRIO_N 50 75 9.15e-5 SMART
SEC14 96 254 1.02e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159533
Predicted Effect probably benign
Transcript: ENSMUST00000160299
SMART Domains Protein: ENSMUSP00000125100
Gene: ENSMUSG00000019785

DomainStartEndE-ValueType
CRAL_TRIO_N 50 75 9.15e-5 SMART
Pfam:CRAL_TRIO 98 219 8e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160756
Predicted Effect probably benign
Transcript: ENSMUST00000161692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217704
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the SEC14/CRAL-TRIO family of proteins. A similar protein in rat is thought to function in the endosomal pathway between early endosomes and mature lysosomes. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,987,387 probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Axin1 A G 17: 26,188,038 H535R probably damaging Het
Ccnb3 T A X: 7,007,801 E846D probably benign Het
Cdca7 G A 2: 72,485,287 G365R probably damaging Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Ddx42 A G 11: 106,247,810 T812A probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
Got1l1 A G 8: 27,199,836 probably null Het
Hip1 T C 5: 135,422,172 E451G probably damaging Het
Hs6st2 C T X: 51,681,455 V50I possibly damaging Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Map1s A G 8: 70,912,519 N107D probably damaging Het
Mmel1 T A 4: 154,889,586 V361D probably damaging Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nup210 G T 6: 91,025,242 Q755K probably benign Het
Olfr114 A G 17: 37,589,696 V219A probably benign Het
Olfr638 A G 7: 104,003,832 M186V probably damaging Het
Pih1h3b T A X: 140,106,021 N216K possibly damaging Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Sspo C T 6: 48,480,697 R3178C probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syk A G 13: 52,631,739 D327G probably benign Het
Tbc1d8b C T X: 139,713,391 A391V probably benign Het
Tmed9 A G 13: 55,595,574 E173G probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp92 C T X: 73,420,294 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Clvs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Clvs2 APN 10 33528463 missense probably benign 0.03
IGL02304:Clvs2 APN 10 33528447 missense probably benign 0.02
IGL02967:Clvs2 APN 10 33595788 missense probably damaging 0.98
R0085:Clvs2 UTSW 10 33622546 missense possibly damaging 0.70
R0346:Clvs2 UTSW 10 33622546 missense possibly damaging 0.70
R1228:Clvs2 UTSW 10 33622604 missense probably benign 0.05
R1405:Clvs2 UTSW 10 33513260 makesense probably null
R1405:Clvs2 UTSW 10 33513260 makesense probably null
R2176:Clvs2 UTSW 10 33595815 missense probably damaging 1.00
R2280:Clvs2 UTSW 10 33528500 missense probably damaging 1.00
R4008:Clvs2 UTSW 10 33543462 missense probably damaging 1.00
R4855:Clvs2 UTSW 10 33622646 missense probably damaging 1.00
R5814:Clvs2 UTSW 10 33528507 missense probably benign 0.01
R6265:Clvs2 UTSW 10 33528515 missense possibly damaging 0.93
R6730:Clvs2 UTSW 10 33528521 missense probably damaging 1.00
R7558:Clvs2 UTSW 10 33543464 missense probably damaging 1.00
R7955:Clvs2 UTSW 10 33595812 missense possibly damaging 0.90
R8337:Clvs2 UTSW 10 33528488 missense possibly damaging 0.95
R8423:Clvs2 UTSW 10 33622859 missense possibly damaging 0.58
RF003:Clvs2 UTSW 10 33622925 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGAAATTTCCTGGCCCTCAAG -3'
(R):5'- ATACTCTCCAGAAAAGCTATGGGG -3'

Sequencing Primer
(F):5'- ATGAAAGCGTCATCTGTGCGC -3'
(R):5'- TCTCCAGAAAAGCTATGGGGAAAAAC -3'
Posted On2015-02-18