Incidental Mutation 'R3413:Syk'
ID267820
Institutional Source Beutler Lab
Gene Symbol Syk
Ensembl Gene ENSMUSG00000021457
Gene Namespleen tyrosine kinase
SynonymsSykb
MMRRC Submission 040631-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3413 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location52583173-52648792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52631739 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 327 (D327G)
Ref Sequence ENSEMBL: ENSMUSP00000113852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055087] [ENSMUST00000118756] [ENSMUST00000120135]
PDB Structure
Solution structure of the Vav1 SH2 domain complexed with a Syk-derived doubly phosphorylated peptide [SOLUTION NMR]
Solution structure of the Vav1 SH2 domain complexed with a Syk-derived singly phosphorylated peptide [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000055087
AA Change: D327G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060828
Gene: ENSMUSG00000021457
AA Change: D327G

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118756
AA Change: D304G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112914
Gene: ENSMUSG00000021457
AA Change: D304G

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 342 582 2.68e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120135
AA Change: D327G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113852
Gene: ENSMUSG00000021457
AA Change: D327G

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of non-receptor type Tyr protein kinases. This protein is widely expressed in hematopoietic cells and is involved in coupling activated immunoreceptors to downstream signaling events that mediate diverse cellular responses, including proliferation, differentiation, and phagocytosis. It is thought to be a modulator of epithelial cell growth and a potential tumour suppressor in human breast carcinomas. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mice have high rates of postnatal lethality, exhibit developmental defects of B cells, T cells and osteoclasts, and have defective dendritic cell cross-presentation of antigens from necrotic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,987,387 probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Axin1 A G 17: 26,188,038 H535R probably damaging Het
Ccnb3 T A X: 7,007,801 E846D probably benign Het
Cdca7 G A 2: 72,485,287 G365R probably damaging Het
Clvs2 T A 10: 33,622,971 probably benign Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Ddx42 A G 11: 106,247,810 T812A probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
Got1l1 A G 8: 27,199,836 probably null Het
Hip1 T C 5: 135,422,172 E451G probably damaging Het
Hs6st2 C T X: 51,681,455 V50I possibly damaging Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Map1s A G 8: 70,912,519 N107D probably damaging Het
Mmel1 T A 4: 154,889,586 V361D probably damaging Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nup210 G T 6: 91,025,242 Q755K probably benign Het
Olfr114 A G 17: 37,589,696 V219A probably benign Het
Olfr638 A G 7: 104,003,832 M186V probably damaging Het
Pih1h3b T A X: 140,106,021 N216K possibly damaging Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Sspo C T 6: 48,480,697 R3178C probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Tbc1d8b C T X: 139,713,391 A391V probably benign Het
Tmed9 A G 13: 55,595,574 E173G probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp92 C T X: 73,420,294 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Syk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Syk APN 13 52624748 missense probably benign 0.00
IGL01522:Syk APN 13 52643061 missense probably benign
IGL01957:Syk APN 13 52631740 missense probably benign
IGL01962:Syk APN 13 52610957 missense probably damaging 1.00
IGL02613:Syk APN 13 52643040 missense probably damaging 0.97
IGL02824:Syk APN 13 52623283 splice site probably benign
IGL03130:Syk APN 13 52622732 missense probably benign 0.12
Apricot UTSW 13 52640733 missense probably damaging 1.00
poppy UTSW 13 52640733 missense probably damaging 1.00
Sisyphus UTSW 13 52640790 missense probably damaging 1.00
H8562:Syk UTSW 13 52640621 missense probably damaging 1.00
R0091:Syk UTSW 13 52640733 missense probably damaging 1.00
R0346:Syk UTSW 13 52640659 missense probably damaging 1.00
R1888:Syk UTSW 13 52640790 missense probably damaging 1.00
R1888:Syk UTSW 13 52640790 missense probably damaging 1.00
R1917:Syk UTSW 13 52622708 missense probably damaging 1.00
R2001:Syk UTSW 13 52611238 missense probably benign 0.21
R2919:Syk UTSW 13 52611121 missense probably benign
R3695:Syk UTSW 13 52622765 splice site probably null
R4363:Syk UTSW 13 52640730 missense probably damaging 1.00
R4754:Syk UTSW 13 52612259 intron probably benign
R4755:Syk UTSW 13 52641986 missense probably benign 0.25
R4806:Syk UTSW 13 52632927 missense probably benign 0.14
R4817:Syk UTSW 13 52611206 missense probably benign 0.03
R4903:Syk UTSW 13 52611081 missense probably damaging 1.00
R4997:Syk UTSW 13 52612448 nonsense probably null
R5066:Syk UTSW 13 52641982 missense possibly damaging 0.49
R5114:Syk UTSW 13 52611035 missense probably damaging 1.00
R5267:Syk UTSW 13 52641926 missense probably benign 0.05
R5323:Syk UTSW 13 52631717 missense probably benign 0.00
R5705:Syk UTSW 13 52611047 missense probably benign 0.03
R6190:Syk UTSW 13 52611053 missense probably damaging 0.97
R6892:Syk UTSW 13 52632898 missense probably benign 0.00
R6932:Syk UTSW 13 52612459 splice site probably null
R6977:Syk UTSW 13 52633058 missense probably benign 0.00
R7496:Syk UTSW 13 52612416 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCTCAGGTCCAAACAGTTGC -3'
(R):5'- ACCTGTGGCTGGTGGATATC -3'

Sequencing Primer
(F):5'- GAATGAGATGAGCCTTTCTGACCTC -3'
(R):5'- GCAAAGTTGGAATGGTGC -3'
Posted On2015-02-18