Incidental Mutation 'R3413:Tmed9'
List |< first << previous [record 35 of 43] next >> last >|
ID267821
Institutional Source Beutler Lab
Gene Symbol Tmed9
Ensembl Gene ENSMUSG00000058569
Gene Nametransmembrane p24 trafficking protein 9
Synonyms2400003B06Rik
MMRRC Submission 040631-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R3413 (G1)
Quality Score165
Status Validated
Chromosome13
Chromosomal Location55573732-55597697 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55595574 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 173 (E173G)
Ref Sequence ENSEMBL: ENSMUSP00000105531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064701] [ENSMUST00000100764] [ENSMUST00000109905] [ENSMUST00000133176] [ENSMUST00000224741]
Predicted Effect probably benign
Transcript: ENSMUST00000064701
SMART Domains Protein: ENSMUSP00000068532
Gene: ENSMUSG00000021504

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Glyco_transf_7N 62 177 8.5e-27 PFAM
Pfam:Glyco_transf_7C 181 260 2.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100764
SMART Domains Protein: ENSMUSP00000098327
Gene: ENSMUSG00000021504

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Glyco_transf_7N 72 180 9.2e-29 PFAM
Pfam:Glyco_transf_7C 181 263 1.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109905
AA Change: E173G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105531
Gene: ENSMUSG00000058569
AA Change: E173G

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
EMP24_GP25L 37 230 2.43e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133176
SMART Domains Protein: ENSMUSP00000123292
Gene: ENSMUSG00000021504

DomainStartEndE-ValueType
Pfam:Glyco_transf_7N 18 124 1.1e-28 PFAM
Pfam:Glyco_transf_7C 125 204 5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224634
Predicted Effect probably benign
Transcript: ENSMUST00000224741
AA Change: E147G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225888
Meta Mutation Damage Score 0.1299 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a family of genes encoding transport proteins located in the endoplasmic reticulum and the Golgi. A similar gene in mouse is the target of microRNA miR-296, which is part of an imprinted cluster. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,987,387 probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Axin1 A G 17: 26,188,038 H535R probably damaging Het
Ccnb3 T A X: 7,007,801 E846D probably benign Het
Cdca7 G A 2: 72,485,287 G365R probably damaging Het
Clvs2 T A 10: 33,622,971 probably benign Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Ddx42 A G 11: 106,247,810 T812A probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
Got1l1 A G 8: 27,199,836 probably null Het
Hip1 T C 5: 135,422,172 E451G probably damaging Het
Hs6st2 C T X: 51,681,455 V50I possibly damaging Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Map1s A G 8: 70,912,519 N107D probably damaging Het
Mmel1 T A 4: 154,889,586 V361D probably damaging Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nup210 G T 6: 91,025,242 Q755K probably benign Het
Olfr114 A G 17: 37,589,696 V219A probably benign Het
Olfr638 A G 7: 104,003,832 M186V probably damaging Het
Pih1h3b T A X: 140,106,021 N216K possibly damaging Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Sspo C T 6: 48,480,697 R3178C probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syk A G 13: 52,631,739 D327G probably benign Het
Tbc1d8b C T X: 139,713,391 A391V probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp92 C T X: 73,420,294 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Tmed9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Tmed9 APN 13 55593521 missense probably benign 0.02
IGL02178:Tmed9 APN 13 55593295 missense possibly damaging 0.95
IGL03060:Tmed9 APN 13 55595508 missense possibly damaging 0.63
IGL03323:Tmed9 APN 13 55596878 missense probably damaging 0.98
R2190:Tmed9 UTSW 13 55593343 missense probably benign 0.01
R3038:Tmed9 UTSW 13 55596979 missense probably damaging 1.00
R7298:Tmed9 UTSW 13 55593294 missense possibly damaging 0.52
R7751:Tmed9 UTSW 13 55593241 missense not run
R7800:Tmed9 UTSW 13 55595532 missense probably benign 0.03
R8343:Tmed9 UTSW 13 55594804 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCATAGCATTGAGGGTGTCTC -3'
(R):5'- TTTTAGACCTGCACTCTGGC -3'

Sequencing Primer
(F):5'- GTCTCAGTGTGTGATCTGAATTTAAC -3'
(R):5'- CTGCACTCTGGCATAGGTAAGTC -3'
Posted On2015-02-18