Incidental Mutation 'R3413:Top1mt'
List |< first << previous [record 36 of 43] next >> last >|
ID267822
Institutional Source Beutler Lab
Gene Symbol Top1mt
Ensembl Gene ENSMUSG00000000934
Gene NameDNA topoisomerase 1, mitochondrial
Synonyms
MMRRC Submission 040631-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R3413 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location75657035-75678800 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75657176 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 573 (N573S)
Ref Sequence ENSEMBL: ENSMUSP00000000958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000958]
Predicted Effect probably benign
Transcript: ENSMUST00000000958
AA Change: N573S

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000000958
Gene: ENSMUSG00000000934
AA Change: N573S

DomainStartEndE-ValueType
Blast:TOPEUc 72 150 4e-38 BLAST
low complexity region 151 166 N/A INTRINSIC
TOPEUc 189 565 5.86e-230 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184801
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial DNA topoisomerase that plays a role in the modification of DNA topology. The encoded protein is a type IB topoisomerase and catalyzes the transient breaking and rejoining of DNA to relieve tension and DNA supercoiling generated in the mitochondrial genome during replication and transcription. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a null allele display increased oxidative stress and lipid peroxidation, enhanced glycolysis, and mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,987,387 probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Axin1 A G 17: 26,188,038 H535R probably damaging Het
Ccnb3 T A X: 7,007,801 E846D probably benign Het
Cdca7 G A 2: 72,485,287 G365R probably damaging Het
Clvs2 T A 10: 33,622,971 probably benign Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Ddx42 A G 11: 106,247,810 T812A probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
Got1l1 A G 8: 27,199,836 probably null Het
Hip1 T C 5: 135,422,172 E451G probably damaging Het
Hs6st2 C T X: 51,681,455 V50I possibly damaging Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Map1s A G 8: 70,912,519 N107D probably damaging Het
Mmel1 T A 4: 154,889,586 V361D probably damaging Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nup210 G T 6: 91,025,242 Q755K probably benign Het
Olfr114 A G 17: 37,589,696 V219A probably benign Het
Olfr638 A G 7: 104,003,832 M186V probably damaging Het
Pih1h3b T A X: 140,106,021 N216K possibly damaging Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Sspo C T 6: 48,480,697 R3178C probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syk A G 13: 52,631,739 D327G probably benign Het
Tbc1d8b C T X: 139,713,391 A391V probably benign Het
Tmed9 A G 13: 55,595,574 E173G probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp92 C T X: 73,420,294 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Top1mt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Top1mt APN 15 75657143 missense possibly damaging 0.47
IGL02111:Top1mt APN 15 75665706 splice site probably benign
IGL02425:Top1mt APN 15 75676121 missense probably benign
IGL02662:Top1mt APN 15 75668705 missense probably damaging 1.00
R1240:Top1mt UTSW 15 75670067 missense probably damaging 0.99
R1438:Top1mt UTSW 15 75674398 missense probably damaging 1.00
R1732:Top1mt UTSW 15 75666251 critical splice donor site probably null
R1884:Top1mt UTSW 15 75667901 missense possibly damaging 0.81
R3414:Top1mt UTSW 15 75657176 missense probably benign 0.41
R4677:Top1mt UTSW 15 75664058 missense possibly damaging 0.48
R4784:Top1mt UTSW 15 75657703 missense probably damaging 1.00
R4784:Top1mt UTSW 15 75676031 missense possibly damaging 0.88
R4791:Top1mt UTSW 15 75668625 critical splice donor site probably null
R6339:Top1mt UTSW 15 75665656 missense possibly damaging 0.72
R6723:Top1mt UTSW 15 75667433 missense probably benign 0.01
R6732:Top1mt UTSW 15 75669488 splice site probably null
R6841:Top1mt UTSW 15 75676124 missense probably benign 0.00
R6884:Top1mt UTSW 15 75664044 missense probably benign 0.37
R7024:Top1mt UTSW 15 75667448 missense probably damaging 1.00
R7052:Top1mt UTSW 15 75668711 missense possibly damaging 0.82
R7055:Top1mt UTSW 15 75678674 missense probably benign 0.01
R7273:Top1mt UTSW 15 75664082 missense probably benign 0.27
R8032:Top1mt UTSW 15 75668723 missense probably damaging 1.00
R8284:Top1mt UTSW 15 75667863 nonsense probably null
R8510:Top1mt UTSW 15 75669302 missense probably benign 0.02
X0028:Top1mt UTSW 15 75657131 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAAGGTCAGTCAGTGTTGTTG -3'
(R):5'- CAGGGATGTCATGATACGTGGG -3'

Sequencing Primer
(F):5'- GGGGCCTTTGTTCTAGGTCAC -3'
(R):5'- TGTCATGATACGTGGGGAAGGAATAC -3'
Posted On2015-02-18