Incidental Mutation 'R3413:Ccnb3'
ID267829
Institutional Source Beutler Lab
Gene Symbol Ccnb3
Ensembl Gene ENSMUSG00000051592
Gene Namecyclin B3
Synonyms
MMRRC Submission 040631-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R3413 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location6979652-7041619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7007801 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 846 (E846D)
Ref Sequence ENSEMBL: ENSMUSP00000111418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056725] [ENSMUST00000115752]
Predicted Effect probably benign
Transcript: ENSMUST00000056725
AA Change: E846D

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000052272
Gene: ENSMUSG00000051592
AA Change: E846D

DomainStartEndE-ValueType
low complexity region 255 267 N/A INTRINSIC
low complexity region 370 379 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 795 819 N/A INTRINSIC
low complexity region 896 907 N/A INTRINSIC
CYCLIN 1172 1256 9.43e-16 SMART
Cyclin_C 1265 1381 8.63e-30 SMART
CYCLIN 1269 1353 1.06e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115752
AA Change: E846D

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000111418
Gene: ENSMUSG00000051592
AA Change: E846D

DomainStartEndE-ValueType
low complexity region 255 267 N/A INTRINSIC
low complexity region 370 379 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 795 819 N/A INTRINSIC
low complexity region 896 907 N/A INTRINSIC
CYCLIN 1172 1256 9.43e-16 SMART
Cyclin_C 1265 1381 8.63e-30 SMART
CYCLIN 1269 1353 1.06e-9 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as positive regulators of cyclin-dependent kinases (CDKs), and thereby play an essential role in the control of the cell cycle. Different cyclins exhibit distinct expression and degradation patterns, which contribute to the temporal coordination of each mitotic event. Studies of similar genes in chicken and drosophila suggest that this cyclin may associate with CDC2 and CDK2 kinases, and may be required for proper spindle reorganization and restoration of the interphase nucleus. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,987,387 probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Axin1 A G 17: 26,188,038 H535R probably damaging Het
Cdca7 G A 2: 72,485,287 G365R probably damaging Het
Clvs2 T A 10: 33,622,971 probably benign Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Ddx42 A G 11: 106,247,810 T812A probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
Got1l1 A G 8: 27,199,836 probably null Het
Hip1 T C 5: 135,422,172 E451G probably damaging Het
Hs6st2 C T X: 51,681,455 V50I possibly damaging Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Map1s A G 8: 70,912,519 N107D probably damaging Het
Mmel1 T A 4: 154,889,586 V361D probably damaging Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nup210 G T 6: 91,025,242 Q755K probably benign Het
Olfr114 A G 17: 37,589,696 V219A probably benign Het
Olfr638 A G 7: 104,003,832 M186V probably damaging Het
Pih1h3b T A X: 140,106,021 N216K possibly damaging Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Sspo C T 6: 48,480,697 R3178C probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syk A G 13: 52,631,739 D327G probably benign Het
Tbc1d8b C T X: 139,713,391 A391V probably benign Het
Tmed9 A G 13: 55,595,574 E173G probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp92 C T X: 73,420,294 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Ccnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ccnb3 APN X 6980274 missense probably benign 0.28
R4541:Ccnb3 UTSW X 7009069 missense probably benign
X0020:Ccnb3 UTSW X 7007226 missense probably benign 0.40
X0024:Ccnb3 UTSW X 7009835 missense probably benign
Z1176:Ccnb3 UTSW X 7009375 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCTCCTTCAGAACAGTCACCAG -3'
(R):5'- ACCAGTAGTGATGTTGATGAGCC -3'

Sequencing Primer
(F):5'- AGTCACCAGCTCAGCTCTGTG -3'
(R):5'- TGATGAGCCTCTTAGTCATCAG -3'
Posted On2015-02-18