Incidental Mutation 'R3413:Hs6st2'
ID267830
Institutional Source Beutler Lab
Gene Symbol Hs6st2
Ensembl Gene ENSMUSG00000062184
Gene Nameheparan sulfate 6-O-sulfotransferase 2
Synonyms6OST2
MMRRC Submission 040631-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3413 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location51387212-51681856 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 51681455 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 50 (V50I)
Ref Sequence ENSEMBL: ENSMUSP00000110521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088172] [ENSMUST00000114871]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088172
AA Change: V50I

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000085497
Gene: ENSMUSG00000062184
AA Change: V50I

DomainStartEndE-ValueType
low complexity region 78 107 N/A INTRINSIC
transmembrane domain 154 173 N/A INTRINSIC
Pfam:Sulfotransfer_2 219 531 1.1e-77 PFAM
low complexity region 571 604 N/A INTRINSIC
low complexity region 622 640 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114871
AA Change: V50I

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110521
Gene: ENSMUSG00000062184
AA Change: V50I

DomainStartEndE-ValueType
low complexity region 78 107 N/A INTRINSIC
transmembrane domain 154 173 N/A INTRINSIC
Pfam:Sulfotransfer_2 219 491 1.3e-78 PFAM
low complexity region 531 564 N/A INTRINSIC
low complexity region 582 600 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142983
Meta Mutation Damage Score 0.0964 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate proteoglycans are ubiquitous components of the cell surface, extracellular matrix, and basement membranes, and interact with various ligands to influence cell growth, differentiation, adhesion, and migration. This gene encodes a member of the heparan sulfate (HS) sulfotransferase gene family, which catalyze the transfer of sulfate to HS. Different family members and isoforms are thought to synthesize heparan sulfates with tissue-specific structures and functions. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female homozygous or male hemizygous mice for a disruption in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,987,387 probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Axin1 A G 17: 26,188,038 H535R probably damaging Het
Ccnb3 T A X: 7,007,801 E846D probably benign Het
Cdca7 G A 2: 72,485,287 G365R probably damaging Het
Clvs2 T A 10: 33,622,971 probably benign Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Ddx42 A G 11: 106,247,810 T812A probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
Got1l1 A G 8: 27,199,836 probably null Het
Hip1 T C 5: 135,422,172 E451G probably damaging Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Map1s A G 8: 70,912,519 N107D probably damaging Het
Mmel1 T A 4: 154,889,586 V361D probably damaging Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nup210 G T 6: 91,025,242 Q755K probably benign Het
Olfr114 A G 17: 37,589,696 V219A probably benign Het
Olfr638 A G 7: 104,003,832 M186V probably damaging Het
Pih1h3b T A X: 140,106,021 N216K possibly damaging Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Sspo C T 6: 48,480,697 R3178C probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syk A G 13: 52,631,739 D327G probably benign Het
Tbc1d8b C T X: 139,713,391 A391V probably benign Het
Tmed9 A G 13: 55,595,574 E173G probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp92 C T X: 73,420,294 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Hs6st2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02436:Hs6st2 APN X 51680014 missense possibly damaging 0.59
X0057:Hs6st2 UTSW X 51680310 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGATCGCACTGAGCACG -3'
(R):5'- TAGTACCCTGAGTTGCCTGAAG -3'

Sequencing Primer
(F):5'- CACGTGCTTGAGCGAGTG -3'
(R):5'- AATGGCACTGCCTGCGTTT -3'
Posted On2015-02-18