Incidental Mutation 'R3413:Zfp92'
ID267831
Institutional Source Beutler Lab
Gene Symbol Zfp92
Ensembl Gene ENSMUSG00000031374
Gene Namezinc finger protein 92
Synonyms
MMRRC Submission 040631-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3413 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location73411096-73428385 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 73420294 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033740] [ENSMUST00000086470]
Predicted Effect probably benign
Transcript: ENSMUST00000033740
SMART Domains Protein: ENSMUSP00000033740
Gene: ENSMUSG00000031374

DomainStartEndE-ValueType
KRAB 14 74 3.17e-35 SMART
ZnF_C2H2 141 163 5.14e-3 SMART
ZnF_C2H2 169 191 1.84e-4 SMART
ZnF_C2H2 197 219 6.88e-4 SMART
ZnF_C2H2 225 247 7.9e-4 SMART
ZnF_C2H2 253 275 1.3e-4 SMART
ZnF_C2H2 281 303 1.38e-3 SMART
ZnF_C2H2 309 331 2.01e1 SMART
ZnF_C2H2 337 359 9.08e-4 SMART
ZnF_C2H2 410 432 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086470
SMART Domains Protein: ENSMUSP00000083661
Gene: ENSMUSG00000031374

DomainStartEndE-ValueType
KRAB 14 74 3.17e-35 SMART
ZnF_C2H2 141 163 5.14e-3 SMART
ZnF_C2H2 169 191 1.84e-4 SMART
ZnF_C2H2 197 219 6.88e-4 SMART
ZnF_C2H2 225 247 7.9e-4 SMART
ZnF_C2H2 253 275 1.3e-4 SMART
ZnF_C2H2 281 303 1.38e-3 SMART
ZnF_C2H2 309 331 2.01e1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,987,387 probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Axin1 A G 17: 26,188,038 H535R probably damaging Het
Ccnb3 T A X: 7,007,801 E846D probably benign Het
Cdca7 G A 2: 72,485,287 G365R probably damaging Het
Clvs2 T A 10: 33,622,971 probably benign Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Ddx42 A G 11: 106,247,810 T812A probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
Got1l1 A G 8: 27,199,836 probably null Het
Hip1 T C 5: 135,422,172 E451G probably damaging Het
Hs6st2 C T X: 51,681,455 V50I possibly damaging Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Map1s A G 8: 70,912,519 N107D probably damaging Het
Mmel1 T A 4: 154,889,586 V361D probably damaging Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nup210 G T 6: 91,025,242 Q755K probably benign Het
Olfr114 A G 17: 37,589,696 V219A probably benign Het
Olfr638 A G 7: 104,003,832 M186V probably damaging Het
Pih1h3b T A X: 140,106,021 N216K possibly damaging Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Sspo C T 6: 48,480,697 R3178C probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syk A G 13: 52,631,739 D327G probably benign Het
Tbc1d8b C T X: 139,713,391 A391V probably benign Het
Tmed9 A G 13: 55,595,574 E173G probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Zfp92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Zfp92 APN X 73420158 splice site probably benign
R1399:Zfp92 UTSW X 73422795 missense probably benign 0.02
R1399:Zfp92 UTSW X 73422130 missense probably damaging 1.00
R1617:Zfp92 UTSW X 73419860 start gained probably benign
R2231:Zfp92 UTSW X 73422752 missense possibly damaging 0.86
R2232:Zfp92 UTSW X 73422752 missense possibly damaging 0.86
R6369:Zfp92 UTSW X 73421968 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TGAGACAGGCTCCCATGTTTC -3'
(R):5'- TGCGGAAAATGGGTCTGAC -3'

Sequencing Primer
(F):5'- TTCGGATTACCCTGGAATTTAATTC -3'
(R):5'- CGGAAAATGGGTCTGACAGGTTG -3'
Posted On2015-02-18