Incidental Mutation 'R3413:Tbc1d8b'
ID267832
Institutional Source Beutler Lab
Gene Symbol Tbc1d8b
Ensembl Gene ENSMUSG00000042473
Gene NameTBC1 domain family, member 8B
Synonyms
MMRRC Submission 040631-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R3413 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location139684996-139753405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 139713391 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 391 (A391V)
Ref Sequence ENSEMBL: ENSMUSP00000094036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096313] [ENSMUST00000183728]
Predicted Effect probably benign
Transcript: ENSMUST00000096313
AA Change: A391V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000094036
Gene: ENSMUSG00000042473
AA Change: A391V

DomainStartEndE-ValueType
low complexity region 35 56 N/A INTRINSIC
GRAM 145 212 3.66e-21 SMART
GRAM 285 353 2.26e-12 SMART
TBC 483 696 3.9e-58 SMART
Blast:TBC 708 860 9e-80 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183537
Predicted Effect probably benign
Transcript: ENSMUST00000183728
SMART Domains Protein: ENSMUSP00000138884
Gene: ENSMUSG00000098559

DomainStartEndE-ValueType
Pfam:RS4NT 3 40 8.4e-23 PFAM
S4 43 106 4.92e-1 SMART
Pfam:KOW 177 211 2.1e-7 PFAM
Meta Mutation Damage Score 0.0942 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a TBC (Tre-2/Bub2/CDC16) domain. Some mammalian proteins with this domain have been shown to function as Rab-GAPs by binding to specific Rab proteins and affecting their GTPase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,987,387 probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Axin1 A G 17: 26,188,038 H535R probably damaging Het
Ccnb3 T A X: 7,007,801 E846D probably benign Het
Cdca7 G A 2: 72,485,287 G365R probably damaging Het
Clvs2 T A 10: 33,622,971 probably benign Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Ddx42 A G 11: 106,247,810 T812A probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
Got1l1 A G 8: 27,199,836 probably null Het
Hip1 T C 5: 135,422,172 E451G probably damaging Het
Hs6st2 C T X: 51,681,455 V50I possibly damaging Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Map1s A G 8: 70,912,519 N107D probably damaging Het
Mmel1 T A 4: 154,889,586 V361D probably damaging Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nup210 G T 6: 91,025,242 Q755K probably benign Het
Olfr114 A G 17: 37,589,696 V219A probably benign Het
Olfr638 A G 7: 104,003,832 M186V probably damaging Het
Pih1h3b T A X: 140,106,021 N216K possibly damaging Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Sspo C T 6: 48,480,697 R3178C probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syk A G 13: 52,631,739 D327G probably benign Het
Tmed9 A G 13: 55,595,574 E173G probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp92 C T X: 73,420,294 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Tbc1d8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Tbc1d8b APN X 139725880 critical splice donor site probably null
IGL02499:Tbc1d8b APN X 139712424 missense probably damaging 1.00
R0676:Tbc1d8b UTSW X 139712276 missense possibly damaging 0.77
R1709:Tbc1d8b UTSW X 139734080 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAGAAAATGCGACTGACTTC -3'
(R):5'- CATGCTAGATTAAACAGCATGGTG -3'

Sequencing Primer
(F):5'- GAGAAAATGCGACTGACTTCTTTATC -3'
(R):5'- AGATTAAACAGCATGGTGAAACTAC -3'
Posted On2015-02-18