Incidental Mutation 'R3424:Hoxd4'
ID267838
Institutional Source Beutler Lab
Gene Symbol Hoxd4
Ensembl Gene ENSMUSG00000101174
Gene Namehomeobox D4
SynonymsHox-4.2, Hox-5.1
MMRRC Submission 040642-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R3424 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location74711929-74729123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74727313 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 12 (Y12C)
Ref Sequence ENSEMBL: ENSMUSP00000051355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047904] [ENSMUST00000053932] [ENSMUST00000111980] [ENSMUST00000111983]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047904
AA Change: Y12C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047949
Gene: ENSMUSG00000115956
AA Change: Y12C

DomainStartEndE-ValueType
low complexity region 63 70 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 112 123 N/A INTRINSIC
HOX 152 214 2.46e-26 SMART
low complexity region 220 229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053932
AA Change: Y12C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051355
Gene: ENSMUSG00000100642
AA Change: Y12C

DomainStartEndE-ValueType
low complexity region 93 135 N/A INTRINSIC
low complexity region 141 159 N/A INTRINSIC
HOX 195 257 5.83e-28 SMART
Pfam:DUF4074 370 431 1.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083566
Predicted Effect possibly damaging
Transcript: ENSMUST00000111980
AA Change: Y12C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107611
Gene: ENSMUSG00000101174
AA Change: Y12C

DomainStartEndE-ValueType
low complexity region 63 70 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 112 123 N/A INTRINSIC
HOX 152 214 2.46e-26 SMART
low complexity region 220 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111983
SMART Domains Protein: ENSMUSP00000107614
Gene: ENSMUSG00000079277

DomainStartEndE-ValueType
low complexity region 93 135 N/A INTRINSIC
low complexity region 141 159 N/A INTRINSIC
HOX 195 257 5.83e-28 SMART
Pfam:DUF4074 369 431 8.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144040
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located at 2q31-2q37 chromosome regions. Deletions that removed the entire HOXD gene cluster or 5' end of this cluster have been associated with severe limb and genital abnormalities. The protein encoded by this gene may play a role in determining positional values in developing limb buds. Alternatively spliced variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both homozygotes and heterozygotes for a targeted null mutation exhibit homeotic transformations of the second cervical vertebrae and malformed neural arches of C1 to C3 and of the basioccipital bone. Mutants show variable penetrance and expressivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik G T 12: 31,184,633 noncoding transcript Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
BC016579 T A 16: 45,629,483 I191F probably damaging Het
Cdh23 T G 10: 60,376,881 I1584L possibly damaging Het
Cep250 G A 2: 155,981,461 D1011N probably benign Het
Coro2b A T 9: 62,429,308 probably null Het
Csf3r A G 4: 126,043,756 D811G probably damaging Het
Dst T G 1: 34,198,505 probably benign Het
Gabrr1 T C 4: 33,158,058 L227P probably damaging Het
Galnt10 T C 11: 57,645,713 V52A probably benign Het
Golga4 A C 9: 118,534,647 D229A probably benign Het
Heatr5b G A 17: 78,768,404 T1495I possibly damaging Het
Hps1 A T 19: 42,760,513 M522K possibly damaging Het
Lrrc8e A T 8: 4,234,611 I279F probably damaging Het
Mettl24 C T 10: 40,683,641 Q96* probably null Het
Muc2 A G 7: 141,693,352 N193S probably damaging Het
Mysm1 A G 4: 94,965,321 L347P probably benign Het
Olfr979 T A 9: 40,000,534 E231V probably damaging Het
Oxtr G T 6: 112,477,230 H24Q probably benign Het
Paxip1 A G 5: 27,775,673 probably benign Het
Pclo C T 5: 14,680,418 probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmeff2 A G 1: 50,979,617 probably benign Het
Tspan31 T A 10: 127,068,502 Q141L probably benign Het
Virma G T 4: 11,513,177 E344* probably null Het
Zbtb17 G T 4: 141,464,988 G415C probably damaging Het
Other mutations in Hoxd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Hoxd4 APN 2 74728406 missense probably damaging 0.98
IGL03403:Hoxd4 APN 2 74728337 missense possibly damaging 0.93
R0153:Hoxd4 UTSW 2 74727457 missense probably damaging 0.96
R5447:Hoxd4 UTSW 2 74727343 missense probably damaging 1.00
R5715:Hoxd4 UTSW 2 74727364 missense probably damaging 1.00
R6197:Hoxd4 UTSW 2 74728463 missense possibly damaging 0.85
R6264:Hoxd4 UTSW 2 74727385 missense possibly damaging 0.53
R6310:Hoxd4 UTSW 2 74728390 missense possibly damaging 0.84
R6336:Hoxd4 UTSW 2 74727361 missense probably damaging 1.00
R6921:Hoxd4 UTSW 2 74728492 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CCGGTGATAAACATGCTTTCTTCC -3'
(R):5'- ATCCAAGGGTAGACCACAGC -3'

Sequencing Primer
(F):5'- CTATTGGCTGGCCTGGTCAC -3'
(R):5'- ACCGTAATGACTTCCCGGG -3'
Posted On2015-02-18