Incidental Mutation 'R3424:Gabrr1'
ID267841
Institutional Source Beutler Lab
Gene Symbol Gabrr1
Ensembl Gene ENSMUSG00000028280
Gene Namegamma-aminobutyric acid (GABA) C receptor, subunit rho 1
SynonymsGABA-C
MMRRC Submission 040642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R3424 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location33132521-33163588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33158058 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 227 (L227P)
Ref Sequence ENSEMBL: ENSMUSP00000029947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029947]
Predicted Effect probably damaging
Transcript: ENSMUST00000029947
AA Change: L227P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029947
Gene: ENSMUSG00000028280
AA Change: L227P

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 69 276 4.8e-53 PFAM
Pfam:Neur_chan_memb 283 402 3.1e-33 PFAM
transmembrane domain 453 472 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. GABRR1 is a member of the rho subunit family. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display altered visual processing in the retina. Mice homozygous for a different knock-out allele exhibit alterations of mechanical pain sensitivity, GABA-inhibited spinal cord responses, and olfactory function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik G T 12: 31,184,633 noncoding transcript Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
BC016579 T A 16: 45,629,483 I191F probably damaging Het
Cdh23 T G 10: 60,376,881 I1584L possibly damaging Het
Cep250 G A 2: 155,981,461 D1011N probably benign Het
Coro2b A T 9: 62,429,308 probably null Het
Csf3r A G 4: 126,043,756 D811G probably damaging Het
Dst T G 1: 34,198,505 probably benign Het
Galnt10 T C 11: 57,645,713 V52A probably benign Het
Golga4 A C 9: 118,534,647 D229A probably benign Het
Heatr5b G A 17: 78,768,404 T1495I possibly damaging Het
Hoxd4 A G 2: 74,727,313 Y12C probably damaging Het
Hps1 A T 19: 42,760,513 M522K possibly damaging Het
Lrrc8e A T 8: 4,234,611 I279F probably damaging Het
Mettl24 C T 10: 40,683,641 Q96* probably null Het
Muc2 A G 7: 141,693,352 N193S probably damaging Het
Mysm1 A G 4: 94,965,321 L347P probably benign Het
Olfr979 T A 9: 40,000,534 E231V probably damaging Het
Oxtr G T 6: 112,477,230 H24Q probably benign Het
Paxip1 A G 5: 27,775,673 probably benign Het
Pclo C T 5: 14,680,418 probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmeff2 A G 1: 50,979,617 probably benign Het
Tspan31 T A 10: 127,068,502 Q141L probably benign Het
Virma G T 4: 11,513,177 E344* probably null Het
Zbtb17 G T 4: 141,464,988 G415C probably damaging Het
Other mutations in Gabrr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Gabrr1 APN 4 33162634 missense probably benign
IGL02052:Gabrr1 APN 4 33152567 missense probably damaging 0.98
IGL02169:Gabrr1 APN 4 33160261 missense probably damaging 1.00
IGL02834:Gabrr1 APN 4 33151426 missense probably damaging 1.00
PIT4498001:Gabrr1 UTSW 4 33160225 missense probably damaging 1.00
R0135:Gabrr1 UTSW 4 33160224 missense probably damaging 1.00
R0606:Gabrr1 UTSW 4 33132696 missense probably benign 0.30
R0739:Gabrr1 UTSW 4 33162781 missense probably benign 0.08
R0843:Gabrr1 UTSW 4 33161717 missense possibly damaging 0.93
R1182:Gabrr1 UTSW 4 33132680 missense probably benign
R1628:Gabrr1 UTSW 4 33152432 missense probably damaging 1.00
R1724:Gabrr1 UTSW 4 33161651 missense probably damaging 0.98
R2300:Gabrr1 UTSW 4 33152449 missense probably benign 0.01
R2405:Gabrr1 UTSW 4 33157110 missense probably damaging 1.00
R3500:Gabrr1 UTSW 4 33158184 splice site probably benign
R4575:Gabrr1 UTSW 4 33158175 missense possibly damaging 0.94
R4923:Gabrr1 UTSW 4 33162820 missense possibly damaging 0.59
R5686:Gabrr1 UTSW 4 33161684 missense probably damaging 0.98
R5941:Gabrr1 UTSW 4 33162676 missense probably benign 0.01
R6122:Gabrr1 UTSW 4 33161695 missense probably damaging 1.00
R6217:Gabrr1 UTSW 4 33149026 splice site probably null
R6232:Gabrr1 UTSW 4 33161632 missense probably benign 0.41
R6489:Gabrr1 UTSW 4 33162855 missense probably benign 0.02
R6793:Gabrr1 UTSW 4 33162712 missense possibly damaging 0.66
R6996:Gabrr1 UTSW 4 33158157 missense probably damaging 0.96
R7396:Gabrr1 UTSW 4 33160207 missense probably damaging 1.00
R7465:Gabrr1 UTSW 4 33146970 missense probably benign
R7597:Gabrr1 UTSW 4 33148964 missense probably benign 0.17
R8170:Gabrr1 UTSW 4 33162718 missense probably damaging 1.00
R8418:Gabrr1 UTSW 4 33162615 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTTTAAGCATCAGAGCCTTGC -3'
(R):5'- ATAGAGCCTGAACCCTCCAG -3'

Sequencing Primer
(F):5'- ACTGGGAAGACTTCGAATTGTC -3'
(R):5'- GCCAAGAGAACTCCTCCCTG -3'
Posted On2015-02-18