Incidental Mutation 'R3424:Mysm1'
ID267842
Institutional Source Beutler Lab
Gene Symbol Mysm1
Ensembl Gene ENSMUSG00000062627
Gene Namemyb-like, SWIRM and MPN domains 1
SynonymsC130067A03Rik, C530050H10Rik
MMRRC Submission 040642-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.890) question?
Stock #R3424 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location94942040-94979100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94965321 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 347 (L347P)
Ref Sequence ENSEMBL: ENSMUSP00000075269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075872]
Predicted Effect probably benign
Transcript: ENSMUST00000075872
AA Change: L347P

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000075269
Gene: ENSMUSG00000062627
AA Change: L347P

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
SANT 114 162 3.24e-13 SMART
low complexity region 214 229 N/A INTRINSIC
Pfam:SWIRM 365 452 3.1e-22 PFAM
JAB_MPN 569 691 1.63e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155935
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes exhibit pigmentation, epidermis, hair follicle and hair cycle abnormalities. Abnormalities in behavior, the hematopoietic and immune systems, body size, metabolism, and skeletal and eye phenotypes are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik G T 12: 31,184,633 noncoding transcript Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
BC016579 T A 16: 45,629,483 I191F probably damaging Het
Cdh23 T G 10: 60,376,881 I1584L possibly damaging Het
Cep250 G A 2: 155,981,461 D1011N probably benign Het
Coro2b A T 9: 62,429,308 probably null Het
Csf3r A G 4: 126,043,756 D811G probably damaging Het
Dst T G 1: 34,198,505 probably benign Het
Gabrr1 T C 4: 33,158,058 L227P probably damaging Het
Galnt10 T C 11: 57,645,713 V52A probably benign Het
Golga4 A C 9: 118,534,647 D229A probably benign Het
Heatr5b G A 17: 78,768,404 T1495I possibly damaging Het
Hoxd4 A G 2: 74,727,313 Y12C probably damaging Het
Hps1 A T 19: 42,760,513 M522K possibly damaging Het
Lrrc8e A T 8: 4,234,611 I279F probably damaging Het
Mettl24 C T 10: 40,683,641 Q96* probably null Het
Muc2 A G 7: 141,693,352 N193S probably damaging Het
Olfr979 T A 9: 40,000,534 E231V probably damaging Het
Oxtr G T 6: 112,477,230 H24Q probably benign Het
Paxip1 A G 5: 27,775,673 probably benign Het
Pclo C T 5: 14,680,418 probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmeff2 A G 1: 50,979,617 probably benign Het
Tspan31 T A 10: 127,068,502 Q141L probably benign Het
Virma G T 4: 11,513,177 E344* probably null Het
Zbtb17 G T 4: 141,464,988 G415C probably damaging Het
Other mutations in Mysm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Mysm1 APN 4 94972909 splice site probably benign
IGL00657:Mysm1 APN 4 94960365 missense probably benign 0.17
IGL00908:Mysm1 APN 4 94958935 missense probably damaging 1.00
IGL01095:Mysm1 APN 4 94967869 critical splice donor site probably null
IGL02454:Mysm1 APN 4 94970504 splice site probably benign
IGL02544:Mysm1 APN 4 94952306 missense probably damaging 1.00
IGL02815:Mysm1 APN 4 94957048 critical splice donor site probably null
IGL02966:Mysm1 APN 4 94975286 missense probably benign 0.31
IGL03273:Mysm1 APN 4 94965718 missense probably damaging 1.00
R1746:Mysm1 UTSW 4 94948411 nonsense probably null
R1826:Mysm1 UTSW 4 94970686 missense probably benign 0.01
R1980:Mysm1 UTSW 4 94952213 missense probably benign 0.27
R3700:Mysm1 UTSW 4 94970652 missense probably benign 0.04
R4243:Mysm1 UTSW 4 94969011 missense probably benign 0.15
R4798:Mysm1 UTSW 4 94965673 missense probably benign 0.00
R4884:Mysm1 UTSW 4 94958948 missense probably damaging 0.98
R4983:Mysm1 UTSW 4 94972970 missense probably benign 0.01
R5024:Mysm1 UTSW 4 94951016 missense possibly damaging 0.47
R5213:Mysm1 UTSW 4 94948377 missense probably damaging 0.96
R5758:Mysm1 UTSW 4 94952361 missense probably damaging 0.98
R6129:Mysm1 UTSW 4 94967955 missense probably damaging 1.00
R7399:Mysm1 UTSW 4 94961727 missense probably benign 0.29
R7535:Mysm1 UTSW 4 94952215 missense probably benign 0.01
R7793:Mysm1 UTSW 4 94965132 missense probably damaging 0.99
R7861:Mysm1 UTSW 4 94946967 makesense probably null
R7923:Mysm1 UTSW 4 94961765 missense probably damaging 1.00
R8117:Mysm1 UTSW 4 94960390 nonsense probably null
R8352:Mysm1 UTSW 4 94975273 missense probably damaging 0.97
R8389:Mysm1 UTSW 4 94965612 missense probably benign 0.00
R8452:Mysm1 UTSW 4 94975273 missense probably damaging 0.97
X0021:Mysm1 UTSW 4 94975225 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGGGCCGAATCAATATAC -3'
(R):5'- AGCTCAGAAATTGCATCATGGG -3'

Sequencing Primer
(F):5'- GCATGGGCCGAATCAATATACTTTAG -3'
(R):5'- TTGCATCATGGGCTGAAAAAC -3'
Posted On2015-02-18