Incidental Mutation 'R3424:Csf3r'
ID267843
Institutional Source Beutler Lab
Gene Symbol Csf3r
Ensembl Gene ENSMUSG00000028859
Gene Namecolony stimulating factor 3 receptor (granulocyte)
SynonymsG-CSFR, Cd114, Csfgr
MMRRC Submission 040642-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R3424 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126024550-126044440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126043756 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 811 (D811G)
Ref Sequence ENSEMBL: ENSMUSP00000101768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030673] [ENSMUST00000030675] [ENSMUST00000106162]
Predicted Effect probably damaging
Transcript: ENSMUST00000030673
AA Change: D811G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030673
Gene: ENSMUSG00000028859
AA Change: D811G

DomainStartEndE-ValueType
Pfam:Lep_receptor_Ig 24 111 2.3e-30 PFAM
FN3 124 213 5.38e1 SMART
SCOP:d1cd9b2 226 332 3e-15 SMART
Blast:FN3 334 420 3e-30 BLAST
FN3 432 518 2.41e0 SMART
FN3 530 612 1.92e-3 SMART
transmembrane domain 627 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030675
SMART Domains Protein: ENSMUSP00000030675
Gene: ENSMUSG00000028861

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
Ribosomal_S15 108 189 4.27e-16 SMART
coiled coil region 211 242 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106162
AA Change: D811G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101768
Gene: ENSMUSG00000028859
AA Change: D811G

DomainStartEndE-ValueType
Pfam:Lep_receptor_Ig 22 112 6.8e-30 PFAM
FN3 124 213 5.38e1 SMART
SCOP:d1cd9b2 226 332 3e-15 SMART
Blast:FN3 334 420 3e-30 BLAST
FN3 432 518 2.41e0 SMART
FN3 530 612 1.92e-3 SMART
transmembrane domain 627 649 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140426
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the receptor for colony stimulating factor 3, a cytokine that controls the production, differentiation, and function of granulocytes. The encoded protein, which is a member of the family of cytokine receptors, may also function in some cell surface adhesion or recognition processes. Alternatively spliced transcript variants have been described. Mutations in this gene are a cause of Kostmann syndrome, also known as severe congenital neutropenia. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced numbers of peripheral neutrophils, with fewer hematopoietic progenitors in bone marrow and impaired expansion and terminal differentiation of progenitors into granulocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik G T 12: 31,184,633 noncoding transcript Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
BC016579 T A 16: 45,629,483 I191F probably damaging Het
Cdh23 T G 10: 60,376,881 I1584L possibly damaging Het
Cep250 G A 2: 155,981,461 D1011N probably benign Het
Coro2b A T 9: 62,429,308 probably null Het
Dst T G 1: 34,198,505 probably benign Het
Gabrr1 T C 4: 33,158,058 L227P probably damaging Het
Galnt10 T C 11: 57,645,713 V52A probably benign Het
Golga4 A C 9: 118,534,647 D229A probably benign Het
Heatr5b G A 17: 78,768,404 T1495I possibly damaging Het
Hoxd4 A G 2: 74,727,313 Y12C probably damaging Het
Hps1 A T 19: 42,760,513 M522K possibly damaging Het
Lrrc8e A T 8: 4,234,611 I279F probably damaging Het
Mettl24 C T 10: 40,683,641 Q96* probably null Het
Muc2 A G 7: 141,693,352 N193S probably damaging Het
Mysm1 A G 4: 94,965,321 L347P probably benign Het
Olfr979 T A 9: 40,000,534 E231V probably damaging Het
Oxtr G T 6: 112,477,230 H24Q probably benign Het
Paxip1 A G 5: 27,775,673 probably benign Het
Pclo C T 5: 14,680,418 probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmeff2 A G 1: 50,979,617 probably benign Het
Tspan31 T A 10: 127,068,502 Q141L probably benign Het
Virma G T 4: 11,513,177 E344* probably null Het
Zbtb17 G T 4: 141,464,988 G415C probably damaging Het
Other mutations in Csf3r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Csf3r APN 4 126032127 nonsense probably null
IGL02224:Csf3r APN 4 126043539 missense probably benign 0.36
IGL02558:Csf3r APN 4 126038135 splice site probably benign
R0026:Csf3r UTSW 4 126031884 missense probably benign 0.33
R0033:Csf3r UTSW 4 126031884 missense probably benign 0.33
R0033:Csf3r UTSW 4 126031884 missense probably benign 0.33
R0121:Csf3r UTSW 4 126029849 missense probably benign 0.01
R0413:Csf3r UTSW 4 126039667 splice site probably benign
R0456:Csf3r UTSW 4 126035861 missense probably damaging 0.98
R0479:Csf3r UTSW 4 126043823 missense probably damaging 0.98
R1052:Csf3r UTSW 4 126042988 splice site probably null
R1466:Csf3r UTSW 4 126031932 splice site probably benign
R1512:Csf3r UTSW 4 126029984 missense possibly damaging 0.75
R1902:Csf3r UTSW 4 126042918 missense probably damaging 1.00
R1905:Csf3r UTSW 4 126042745 missense probably benign 0.12
R2520:Csf3r UTSW 4 126035352 missense probably benign 0.06
R3705:Csf3r UTSW 4 126032285 missense possibly damaging 0.76
R3907:Csf3r UTSW 4 126034447 missense probably benign 0.00
R4514:Csf3r UTSW 4 126039860 missense possibly damaging 0.61
R4817:Csf3r UTSW 4 126037656 nonsense probably null
R5111:Csf3r UTSW 4 126030068 splice site probably null
R5120:Csf3r UTSW 4 126035827 missense probably benign 0.00
R5308:Csf3r UTSW 4 126035344 missense probably benign 0.00
R5912:Csf3r UTSW 4 126029960 missense probably damaging 1.00
R6018:Csf3r UTSW 4 126043621 missense probably benign 0.01
R6024:Csf3r UTSW 4 126037517 splice site probably null
R7144:Csf3r UTSW 4 126043722 missense probably benign 0.03
R7615:Csf3r UTSW 4 126037656 nonsense probably null
R7717:Csf3r UTSW 4 126037610 missense probably damaging 1.00
R8443:Csf3r UTSW 4 126029919 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CCTCTATGGTCAGGTGCTTG -3'
(R):5'- ACCTCAGGGTATAGCCTGAG -3'

Sequencing Primer
(F):5'- TTGAGAGCCCCACCAGC -3'
(R):5'- AGAGACACACTGGGCCTTTCTG -3'
Posted On2015-02-18