Incidental Mutation 'R3424:Paxip1'
ID267847
Institutional Source Beutler Lab
Gene Symbol Paxip1
Ensembl Gene ENSMUSG00000002221
Gene NamePAX interacting (with transcription-activation domain) protein 1
SynonymsD5Ertd149e, PTIP
MMRRC Submission 040642-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3424 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location27740080-27791691 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 27775673 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002291] [ENSMUST00000196734]
Predicted Effect unknown
Transcript: ENSMUST00000002291
AA Change: S111P
SMART Domains Protein: ENSMUSP00000002291
Gene: ENSMUSG00000002221
AA Change: S111P

DomainStartEndE-ValueType
BRCT 10 83 6.72e1 SMART
BRCT 96 173 8.83e-15 SMART
low complexity region 189 208 N/A INTRINSIC
low complexity region 214 223 N/A INTRINSIC
coiled coil region 489 547 N/A INTRINSIC
BRCT 590 671 5.74e-14 SMART
BRCT 690 766 1.67e-15 SMART
BRCT 845 924 4.03e-9 SMART
BRCT 957 1046 3.54e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196734
SMART Domains Protein: ENSMUSP00000142578
Gene: ENSMUSG00000002221

DomainStartEndE-ValueType
Blast:BRCT 10 83 5e-48 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a nuclear-localized protein that contains six BRCT1 (C-terminal of breast cancer susceptibility protein) domains. The encoded protein is involved in the repair of DNA double-strand breaks and is necessary for progression through cell division. The protein also functions in the regulation of transcription by recruiting histone methyltransferases to gene promoters bound by the sequence-specific transcription factor paired box protein 2 (Pax2). [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutant mice are developmentally retarded and embyronic lethal by E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik G T 12: 31,184,633 noncoding transcript Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
BC016579 T A 16: 45,629,483 I191F probably damaging Het
Cdh23 T G 10: 60,376,881 I1584L possibly damaging Het
Cep250 G A 2: 155,981,461 D1011N probably benign Het
Coro2b A T 9: 62,429,308 probably null Het
Csf3r A G 4: 126,043,756 D811G probably damaging Het
Dst T G 1: 34,198,505 probably benign Het
Gabrr1 T C 4: 33,158,058 L227P probably damaging Het
Galnt10 T C 11: 57,645,713 V52A probably benign Het
Golga4 A C 9: 118,534,647 D229A probably benign Het
Heatr5b G A 17: 78,768,404 T1495I possibly damaging Het
Hoxd4 A G 2: 74,727,313 Y12C probably damaging Het
Hps1 A T 19: 42,760,513 M522K possibly damaging Het
Lrrc8e A T 8: 4,234,611 I279F probably damaging Het
Mettl24 C T 10: 40,683,641 Q96* probably null Het
Muc2 A G 7: 141,693,352 N193S probably damaging Het
Mysm1 A G 4: 94,965,321 L347P probably benign Het
Olfr979 T A 9: 40,000,534 E231V probably damaging Het
Oxtr G T 6: 112,477,230 H24Q probably benign Het
Pclo C T 5: 14,680,418 probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmeff2 A G 1: 50,979,617 probably benign Het
Tspan31 T A 10: 127,068,502 Q141L probably benign Het
Virma G T 4: 11,513,177 E344* probably null Het
Zbtb17 G T 4: 141,464,988 G415C probably damaging Het
Other mutations in Paxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Paxip1 APN 5 27772552 utr 3 prime probably benign
IGL01705:Paxip1 APN 5 27748859 missense probably damaging 1.00
IGL01844:Paxip1 APN 5 27751038 missense probably benign 0.17
IGL02143:Paxip1 APN 5 27775598 utr 3 prime probably benign
IGL02863:Paxip1 APN 5 27759395 missense probably benign 0.30
IGL02903:Paxip1 APN 5 27748872 missense probably damaging 1.00
IGL03008:Paxip1 APN 5 27752766 missense probably benign 0.01
BB003:Paxip1 UTSW 5 27791209 missense unknown
BB013:Paxip1 UTSW 5 27791209 missense unknown
R0128:Paxip1 UTSW 5 27744185 splice site probably benign
R0130:Paxip1 UTSW 5 27744185 splice site probably benign
R0331:Paxip1 UTSW 5 27765232 missense probably damaging 0.96
R0357:Paxip1 UTSW 5 27758623 splice site probably benign
R0370:Paxip1 UTSW 5 27760086 missense probably damaging 1.00
R0625:Paxip1 UTSW 5 27765942 nonsense probably null
R1969:Paxip1 UTSW 5 27744136 missense probably damaging 1.00
R2214:Paxip1 UTSW 5 27742501 missense probably damaging 1.00
R3808:Paxip1 UTSW 5 27772029 unclassified probably benign
R3809:Paxip1 UTSW 5 27772029 unclassified probably benign
R3881:Paxip1 UTSW 5 27748839 missense probably damaging 1.00
R3882:Paxip1 UTSW 5 27748839 missense probably damaging 1.00
R4685:Paxip1 UTSW 5 27761677 splice site probably null
R4692:Paxip1 UTSW 5 27772097 unclassified probably benign
R4776:Paxip1 UTSW 5 27765206 missense probably damaging 1.00
R5093:Paxip1 UTSW 5 27766284 missense unknown
R5388:Paxip1 UTSW 5 27781455 utr 3 prime probably benign
R5397:Paxip1 UTSW 5 27772004 unclassified probably benign
R5553:Paxip1 UTSW 5 27775639 utr 3 prime probably benign
R6151:Paxip1 UTSW 5 27761618 missense probably damaging 1.00
R6216:Paxip1 UTSW 5 27766173 missense unknown
R6276:Paxip1 UTSW 5 27761668 missense probably damaging 1.00
R6290:Paxip1 UTSW 5 27765578 splice site probably null
R6584:Paxip1 UTSW 5 27758452 missense probably damaging 0.98
R6688:Paxip1 UTSW 5 27744137 missense probably benign 0.18
R6908:Paxip1 UTSW 5 27791224 missense possibly damaging 0.90
R6981:Paxip1 UTSW 5 27765768 nonsense probably null
R7252:Paxip1 UTSW 5 27760086 missense probably damaging 0.96
R7385:Paxip1 UTSW 5 27781420 critical splice donor site probably null
R7585:Paxip1 UTSW 5 27772004 missense unknown
R7665:Paxip1 UTSW 5 27765738 missense unknown
R7926:Paxip1 UTSW 5 27791209 missense unknown
R8169:Paxip1 UTSW 5 27772095 missense unknown
R8335:Paxip1 UTSW 5 27766124 missense unknown
X0066:Paxip1 UTSW 5 27766018 missense unknown
Z1176:Paxip1 UTSW 5 27783729 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTACACAGACTCCAGGCATTGC -3'
(R):5'- TGGCAAACGGCTTCTGTTG -3'

Sequencing Primer
(F):5'- GCATTGCAAAGAGCTCCCTTG -3'
(R):5'- CAAACGGCTTCTGTTGTGAAG -3'
Posted On2015-02-18