Incidental Mutation 'R3424:Lrrc8e'
ID267849
Institutional Source Beutler Lab
Gene Symbol Lrrc8e
Ensembl Gene ENSMUSG00000046589
Gene Nameleucine rich repeat containing 8 family, member E
Synonyms1810049O03Rik, C87354
MMRRC Submission 040642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R3424 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location4226827-4237470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4234611 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 279 (I279F)
Ref Sequence ENSEMBL: ENSMUSP00000052055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003027] [ENSMUST00000053035] [ENSMUST00000062686] [ENSMUST00000110998] [ENSMUST00000110999] [ENSMUST00000145165] [ENSMUST00000207770]
Predicted Effect probably benign
Transcript: ENSMUST00000003027
SMART Domains Protein: ENSMUSP00000003027
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
low complexity region 435 455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053035
AA Change: I279F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052055
Gene: ENSMUSG00000046589
AA Change: I279F

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 330 3.8e-143 PFAM
low complexity region 504 516 N/A INTRINSIC
LRR 603 627 3.97e0 SMART
LRR 628 650 2.33e2 SMART
LRR_TYP 651 674 6.08e-5 SMART
LRR 676 696 6.78e1 SMART
LRR_TYP 697 720 2.43e-4 SMART
LRR 721 742 1.09e2 SMART
LRR_TYP 743 766 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062686
SMART Domains Protein: ENSMUSP00000054512
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110998
SMART Domains Protein: ENSMUSP00000106626
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110999
SMART Domains Protein: ENSMUSP00000106627
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
low complexity region 419 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145165
SMART Domains Protein: ENSMUSP00000117418
Gene: ENSMUSG00000109061

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207770
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small, conserved family of proteins with similar structure, including a string of extracellular leucine-rich repeats. A related protein was shown to be involved in B-cell development. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik G T 12: 31,184,633 noncoding transcript Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
BC016579 T A 16: 45,629,483 I191F probably damaging Het
Cdh23 T G 10: 60,376,881 I1584L possibly damaging Het
Cep250 G A 2: 155,981,461 D1011N probably benign Het
Coro2b A T 9: 62,429,308 probably null Het
Csf3r A G 4: 126,043,756 D811G probably damaging Het
Dst T G 1: 34,198,505 probably benign Het
Gabrr1 T C 4: 33,158,058 L227P probably damaging Het
Galnt10 T C 11: 57,645,713 V52A probably benign Het
Golga4 A C 9: 118,534,647 D229A probably benign Het
Heatr5b G A 17: 78,768,404 T1495I possibly damaging Het
Hoxd4 A G 2: 74,727,313 Y12C probably damaging Het
Hps1 A T 19: 42,760,513 M522K possibly damaging Het
Mettl24 C T 10: 40,683,641 Q96* probably null Het
Muc2 A G 7: 141,693,352 N193S probably damaging Het
Mysm1 A G 4: 94,965,321 L347P probably benign Het
Olfr979 T A 9: 40,000,534 E231V probably damaging Het
Oxtr G T 6: 112,477,230 H24Q probably benign Het
Paxip1 A G 5: 27,775,673 probably benign Het
Pclo C T 5: 14,680,418 probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmeff2 A G 1: 50,979,617 probably benign Het
Tspan31 T A 10: 127,068,502 Q141L probably benign Het
Virma G T 4: 11,513,177 E344* probably null Het
Zbtb17 G T 4: 141,464,988 G415C probably damaging Het
Other mutations in Lrrc8e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lrrc8e APN 8 4235921 missense probably benign
IGL00943:Lrrc8e APN 8 4235658 missense probably damaging 1.00
IGL00979:Lrrc8e APN 8 4235080 missense probably damaging 1.00
IGL01138:Lrrc8e APN 8 4234084 missense probably damaging 1.00
IGL01458:Lrrc8e APN 8 4236141 missense probably damaging 1.00
IGL02524:Lrrc8e APN 8 4235392 missense probably damaging 1.00
IGL02831:Lrrc8e APN 8 4235429 missense probably damaging 0.96
IGL03135:Lrrc8e APN 8 4235776 missense probably damaging 1.00
R0242:Lrrc8e UTSW 8 4235401 missense probably benign 0.00
R0242:Lrrc8e UTSW 8 4235401 missense probably benign 0.00
R0312:Lrrc8e UTSW 8 4235733 missense probably benign
R0601:Lrrc8e UTSW 8 4235239 splice site probably null
R1167:Lrrc8e UTSW 8 4235337 missense probably benign
R1405:Lrrc8e UTSW 8 4231754 missense probably damaging 1.00
R1405:Lrrc8e UTSW 8 4231754 missense probably damaging 1.00
R1540:Lrrc8e UTSW 8 4234990 missense probably benign 0.41
R1677:Lrrc8e UTSW 8 4234190 missense probably damaging 1.00
R1916:Lrrc8e UTSW 8 4235202 missense probably benign 0.01
R2185:Lrrc8e UTSW 8 4234986 nonsense probably null
R2290:Lrrc8e UTSW 8 4231770 missense probably damaging 1.00
R4628:Lrrc8e UTSW 8 4233981 missense probably damaging 1.00
R4996:Lrrc8e UTSW 8 4235166 missense probably damaging 1.00
R5169:Lrrc8e UTSW 8 4234329 missense probably benign
R5516:Lrrc8e UTSW 8 4235818 missense probably damaging 1.00
R5870:Lrrc8e UTSW 8 4235725 missense possibly damaging 0.60
R6687:Lrrc8e UTSW 8 4234798 missense probably damaging 1.00
R6700:Lrrc8e UTSW 8 4236034 missense probably damaging 1.00
R7344:Lrrc8e UTSW 8 4234815 missense probably damaging 1.00
R7350:Lrrc8e UTSW 8 4235626 missense probably benign 0.14
R7555:Lrrc8e UTSW 8 4234363 missense probably benign 0.05
R7691:Lrrc8e UTSW 8 4234534 missense probably damaging 1.00
R8112:Lrrc8e UTSW 8 4235575 missense probably benign 0.14
R8184:Lrrc8e UTSW 8 4235140 missense probably damaging 0.99
R8328:Lrrc8e UTSW 8 4235641 missense probably damaging 1.00
Z1176:Lrrc8e UTSW 8 4234822 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAAGGTGGTGTCTGAGCCTC -3'
(R):5'- GAAGGAGTACTCTTTTAGGGGC -3'

Sequencing Primer
(F):5'- CAGTTGTTACTCTGCTGGATAAGAAG -3'
(R):5'- CTTTTAGGGGCCTATGGAAGAGCC -3'
Posted On2015-02-18