Incidental Mutation 'R3424:Olfr979'
ID267852
Institutional Source Beutler Lab
Gene Symbol Olfr979
Ensembl Gene ENSMUSG00000059473
Gene Nameolfactory receptor 979
SynonymsMOR223-1, GA_x6K02T2PVTD-33699706-33698771
MMRRC Submission 040642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3424 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39998003-40003465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40000534 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 231 (E231V)
Ref Sequence ENSEMBL: ENSMUSP00000148903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080835] [ENSMUST00000215523] [ENSMUST00000216463]
Predicted Effect probably damaging
Transcript: ENSMUST00000080835
AA Change: E231V

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079648
Gene: ENSMUSG00000059473
AA Change: E231V

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 7.9e-58 PFAM
Pfam:7tm_1 39 287 5.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215523
AA Change: E231V

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000216463
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik G T 12: 31,184,633 noncoding transcript Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
BC016579 T A 16: 45,629,483 I191F probably damaging Het
Cdh23 T G 10: 60,376,881 I1584L possibly damaging Het
Cep250 G A 2: 155,981,461 D1011N probably benign Het
Coro2b A T 9: 62,429,308 probably null Het
Csf3r A G 4: 126,043,756 D811G probably damaging Het
Dst T G 1: 34,198,505 probably benign Het
Gabrr1 T C 4: 33,158,058 L227P probably damaging Het
Galnt10 T C 11: 57,645,713 V52A probably benign Het
Golga4 A C 9: 118,534,647 D229A probably benign Het
Heatr5b G A 17: 78,768,404 T1495I possibly damaging Het
Hoxd4 A G 2: 74,727,313 Y12C probably damaging Het
Hps1 A T 19: 42,760,513 M522K possibly damaging Het
Lrrc8e A T 8: 4,234,611 I279F probably damaging Het
Mettl24 C T 10: 40,683,641 Q96* probably null Het
Muc2 A G 7: 141,693,352 N193S probably damaging Het
Mysm1 A G 4: 94,965,321 L347P probably benign Het
Oxtr G T 6: 112,477,230 H24Q probably benign Het
Paxip1 A G 5: 27,775,673 probably benign Het
Pclo C T 5: 14,680,418 probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmeff2 A G 1: 50,979,617 probably benign Het
Tspan31 T A 10: 127,068,502 Q141L probably benign Het
Virma G T 4: 11,513,177 E344* probably null Het
Zbtb17 G T 4: 141,464,988 G415C probably damaging Het
Other mutations in Olfr979
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Olfr979 APN 9 40000886 missense probably damaging 1.00
IGL02939:Olfr979 APN 9 40000898 missense probably benign 0.26
IGL02991:Olfr979 UTSW 9 40000402 missense probably damaging 1.00
R1388:Olfr979 UTSW 9 40000652 missense probably damaging 0.99
R1572:Olfr979 UTSW 9 40001194 missense probably benign 0.35
R2089:Olfr979 UTSW 9 40001204 missense probably benign 0.01
R2091:Olfr979 UTSW 9 40001204 missense probably benign 0.01
R2091:Olfr979 UTSW 9 40001204 missense probably benign 0.01
R2179:Olfr979 UTSW 9 40000924 missense probably benign 0.44
R3964:Olfr979 UTSW 9 40000471 missense possibly damaging 0.95
R3965:Olfr979 UTSW 9 40000471 missense possibly damaging 0.95
R4111:Olfr979 UTSW 9 40000898 nonsense probably null
R4537:Olfr979 UTSW 9 40000320 missense probably benign 0.01
R4737:Olfr979 UTSW 9 40000422 missense probably damaging 0.96
R4926:Olfr979 UTSW 9 40001023 splice site probably null
R5303:Olfr979 UTSW 9 40000588 missense probably damaging 1.00
R5587:Olfr979 UTSW 9 40000621 missense possibly damaging 0.90
R6387:Olfr979 UTSW 9 40000852 missense probably damaging 0.99
R6394:Olfr979 UTSW 9 40000705 missense probably benign 0.04
R6765:Olfr979 UTSW 9 40001197 missense probably damaging 1.00
R7312:Olfr979 UTSW 9 40000810 missense probably benign 0.22
R7463:Olfr979 UTSW 9 40000564 missense probably benign 0.07
R7486:Olfr979 UTSW 9 40000885 missense probably benign 0.39
R7581:Olfr979 UTSW 9 40000422 missense probably damaging 0.96
R8364:Olfr979 UTSW 9 40000364 missense probably benign 0.22
R8414:Olfr979 UTSW 9 40000945 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCAGGGTGTACACAACAGGG -3'
(R):5'- TGTCCAGACTACATTGACCTTC -3'

Sequencing Primer
(F):5'- GTTGAGTAGGGGTGTCAACAC -3'
(R):5'- CAACCAGATCCAGCATTATTTCTGTG -3'
Posted On2015-02-18