Incidental Mutation 'R3424:Slc18b1'
ID267855
Institutional Source Beutler Lab
Gene Symbol Slc18b1
Ensembl Gene ENSMUSG00000037455
Gene Namesolute carrier family 18, subfamily B, member 1
Synonyms1110021L09Rik
MMRRC Submission 040642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3424 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location23796986-23827968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 23822976 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 348 (M348R)
Ref Sequence ENSEMBL: ENSMUSP00000112634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119597] [ENSMUST00000179321]
Predicted Effect probably damaging
Transcript: ENSMUST00000119597
AA Change: M348R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112634
Gene: ENSMUSG00000037455
AA Change: M348R

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 254 3.2e-26 PFAM
Pfam:MFS_1 237 454 7.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143931
Predicted Effect probably damaging
Transcript: ENSMUST00000179321
AA Change: M350R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137431
Gene: ENSMUSG00000037455
AA Change: M350R

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 262 2.4e-26 PFAM
Pfam:LacY_symp 226 454 3.9e-8 PFAM
Pfam:MFS_1 241 456 4.9e-23 PFAM
Pfam:MFS_2 253 458 3.7e-9 PFAM
Meta Mutation Damage Score 0.7218 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, which has high sequence similarity to rat, xenopus and zebrafish proteins. The protein function is unknown. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik G T 12: 31,184,633 noncoding transcript Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
BC016579 T A 16: 45,629,483 I191F probably damaging Het
Cdh23 T G 10: 60,376,881 I1584L possibly damaging Het
Cep250 G A 2: 155,981,461 D1011N probably benign Het
Coro2b A T 9: 62,429,308 probably null Het
Csf3r A G 4: 126,043,756 D811G probably damaging Het
Dst T G 1: 34,198,505 probably benign Het
Gabrr1 T C 4: 33,158,058 L227P probably damaging Het
Galnt10 T C 11: 57,645,713 V52A probably benign Het
Golga4 A C 9: 118,534,647 D229A probably benign Het
Heatr5b G A 17: 78,768,404 T1495I possibly damaging Het
Hoxd4 A G 2: 74,727,313 Y12C probably damaging Het
Hps1 A T 19: 42,760,513 M522K possibly damaging Het
Lrrc8e A T 8: 4,234,611 I279F probably damaging Het
Mettl24 C T 10: 40,683,641 Q96* probably null Het
Muc2 A G 7: 141,693,352 N193S probably damaging Het
Mysm1 A G 4: 94,965,321 L347P probably benign Het
Olfr979 T A 9: 40,000,534 E231V probably damaging Het
Oxtr G T 6: 112,477,230 H24Q probably benign Het
Paxip1 A G 5: 27,775,673 probably benign Het
Pclo C T 5: 14,680,418 probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmeff2 A G 1: 50,979,617 probably benign Het
Tspan31 T A 10: 127,068,502 Q141L probably benign Het
Virma G T 4: 11,513,177 E344* probably null Het
Zbtb17 G T 4: 141,464,988 G415C probably damaging Het
Other mutations in Slc18b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Slc18b1 APN 10 23824761 critical splice donor site probably null
IGL01474:Slc18b1 APN 10 23803850 missense probably benign 0.35
IGL01788:Slc18b1 APN 10 23826001 missense probably damaging 0.96
IGL02660:Slc18b1 APN 10 23810952 splice site probably benign
IGL03049:Slc18b1 APN 10 23822946 missense probably benign 0.01
IGL03106:Slc18b1 APN 10 23826659 makesense probably null
R0440:Slc18b1 UTSW 10 23819078 missense probably benign 0.16
R0633:Slc18b1 UTSW 10 23806038 missense probably benign 0.00
R1086:Slc18b1 UTSW 10 23803795 missense probably benign 0.02
R1572:Slc18b1 UTSW 10 23798741 splice site probably benign
R1842:Slc18b1 UTSW 10 23805993 missense possibly damaging 0.87
R2256:Slc18b1 UTSW 10 23810922 missense probably benign 0.25
R3423:Slc18b1 UTSW 10 23822976 missense probably damaging 0.99
R3425:Slc18b1 UTSW 10 23822976 missense probably damaging 0.99
R3765:Slc18b1 UTSW 10 23798749 missense probably damaging 0.99
R3766:Slc18b1 UTSW 10 23798749 missense probably damaging 0.99
R4063:Slc18b1 UTSW 10 23805981 missense probably benign 0.01
R4779:Slc18b1 UTSW 10 23820869 missense possibly damaging 0.71
R5714:Slc18b1 UTSW 10 23798766 missense probably benign 0.00
R5910:Slc18b1 UTSW 10 23824667 intron probably benign
R6084:Slc18b1 UTSW 10 23804212 missense probably benign 0.15
R6789:Slc18b1 UTSW 10 23816329 missense probably benign 0.02
R6868:Slc18b1 UTSW 10 23804234 missense possibly damaging 0.95
R6959:Slc18b1 UTSW 10 23826044 splice site probably null
R7632:Slc18b1 UTSW 10 23826182 missense probably benign
R8101:Slc18b1 UTSW 10 23822943 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCGCCTCATATTTAAGTTTG -3'
(R):5'- TCACAGCATCTTGTCACTATGC -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- TGCTATCACAGGATGATCTCG -3'
Posted On2015-02-18