Incidental Mutation 'R3424:Mettl24'
ID267856
Institutional Source Beutler Lab
Gene Symbol Mettl24
Ensembl Gene ENSMUSG00000045555
Gene Namemethyltransferase like 24
Synonyms9030224M15Rik
MMRRC Submission 040642-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3424 (G1)
Quality Score146
Status Not validated
Chromosome10
Chromosomal Location40683282-40811083 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 40683641 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 96 (Q96*)
Ref Sequence ENSEMBL: ENSMUSP00000049997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058747] [ENSMUST00000213856]
Predicted Effect probably null
Transcript: ENSMUST00000058747
AA Change: Q96*
SMART Domains Protein: ENSMUSP00000049997
Gene: ENSMUSG00000045555
AA Change: Q96*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 37 51 N/A INTRINSIC
Pfam:Methyltransf_21 131 328 3.8e-8 PFAM
Pfam:Methyltransf_22 139 344 3.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213856
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik G T 12: 31,184,633 noncoding transcript Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
BC016579 T A 16: 45,629,483 I191F probably damaging Het
Cdh23 T G 10: 60,376,881 I1584L possibly damaging Het
Cep250 G A 2: 155,981,461 D1011N probably benign Het
Coro2b A T 9: 62,429,308 probably null Het
Csf3r A G 4: 126,043,756 D811G probably damaging Het
Dst T G 1: 34,198,505 probably benign Het
Gabrr1 T C 4: 33,158,058 L227P probably damaging Het
Galnt10 T C 11: 57,645,713 V52A probably benign Het
Golga4 A C 9: 118,534,647 D229A probably benign Het
Heatr5b G A 17: 78,768,404 T1495I possibly damaging Het
Hoxd4 A G 2: 74,727,313 Y12C probably damaging Het
Hps1 A T 19: 42,760,513 M522K possibly damaging Het
Lrrc8e A T 8: 4,234,611 I279F probably damaging Het
Muc2 A G 7: 141,693,352 N193S probably damaging Het
Mysm1 A G 4: 94,965,321 L347P probably benign Het
Olfr979 T A 9: 40,000,534 E231V probably damaging Het
Oxtr G T 6: 112,477,230 H24Q probably benign Het
Paxip1 A G 5: 27,775,673 probably benign Het
Pclo C T 5: 14,680,418 probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmeff2 A G 1: 50,979,617 probably benign Het
Tspan31 T A 10: 127,068,502 Q141L probably benign Het
Virma G T 4: 11,513,177 E344* probably null Het
Zbtb17 G T 4: 141,464,988 G415C probably damaging Het
Other mutations in Mettl24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Mettl24 APN 10 40810500 missense probably benign 0.05
R0381:Mettl24 UTSW 10 40746390 missense probably damaging 1.00
R0961:Mettl24 UTSW 10 40810619 missense possibly damaging 0.49
R1172:Mettl24 UTSW 10 40737708 missense probably benign 0.01
R1430:Mettl24 UTSW 10 40737795 missense probably damaging 1.00
R1835:Mettl24 UTSW 10 40737816 critical splice donor site probably null
R1940:Mettl24 UTSW 10 40737726 missense probably benign 0.01
R4831:Mettl24 UTSW 10 40683417 missense possibly damaging 0.79
R5430:Mettl24 UTSW 10 40737784 missense probably benign 0.07
R5889:Mettl24 UTSW 10 40746490 missense probably benign 0.27
R6893:Mettl24 UTSW 10 40737798 missense probably damaging 1.00
R7072:Mettl24 UTSW 10 40683513 missense probably benign
R7177:Mettl24 UTSW 10 40810512 missense probably damaging 1.00
R7309:Mettl24 UTSW 10 40810500 missense probably benign 0.05
R7898:Mettl24 UTSW 10 40810482 missense probably benign 0.02
X0022:Mettl24 UTSW 10 40746387 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGAACGCTTCTCTGCAG -3'
(R):5'- TGAGTGAGACTACAGAAAGTTCC -3'

Sequencing Primer
(F):5'- CCTACGGCTTTGCATGGAG -3'
(R):5'- TTCCAGGGAGAGCTCAGCTAG -3'
Posted On2015-02-18