Incidental Mutation 'R3424:Tspan31'
ID267860
Institutional Source Beutler Lab
Gene Symbol Tspan31
Ensembl Gene ENSMUSG00000006736
Gene Nametetraspanin 31
Synonyms2700085A14Rik, Tspan31, Sas
MMRRC Submission 040642-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R3424 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127067280-127070264 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127068502 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 141 (Q141L)
Ref Sequence ENSEMBL: ENSMUSP00000057751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006911] [ENSMUST00000060991] [ENSMUST00000120226] [ENSMUST00000125682] [ENSMUST00000133115] [ENSMUST00000142558]
Predicted Effect probably benign
Transcript: ENSMUST00000006911
SMART Domains Protein: ENSMUSP00000006911
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
S_TKc 6 295 9.2e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060991
AA Change: Q141L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057751
Gene: ENSMUSG00000006736
AA Change: Q141L

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 200 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120226
SMART Domains Protein: ENSMUSP00000112549
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
Pfam:Pkinase 6 103 6e-10 PFAM
low complexity region 121 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123456
Predicted Effect probably benign
Transcript: ENSMUST00000125682
SMART Domains Protein: ENSMUSP00000117234
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
S_TKc 6 261 5.19e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133115
SMART Domains Protein: ENSMUSP00000122973
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
S_TKc 6 250 1.55e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140254
Predicted Effect probably benign
Transcript: ENSMUST00000142558
SMART Domains Protein: ENSMUSP00000116190
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
Pfam:Pkinase 6 74 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218603
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is thought to be involved in growth-related cellular processes. This gene is associated with tumorigenesis and osteosarcoma. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik G T 12: 31,184,633 noncoding transcript Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
BC016579 T A 16: 45,629,483 I191F probably damaging Het
Cdh23 T G 10: 60,376,881 I1584L possibly damaging Het
Cep250 G A 2: 155,981,461 D1011N probably benign Het
Coro2b A T 9: 62,429,308 probably null Het
Csf3r A G 4: 126,043,756 D811G probably damaging Het
Dst T G 1: 34,198,505 probably benign Het
Gabrr1 T C 4: 33,158,058 L227P probably damaging Het
Galnt10 T C 11: 57,645,713 V52A probably benign Het
Golga4 A C 9: 118,534,647 D229A probably benign Het
Heatr5b G A 17: 78,768,404 T1495I possibly damaging Het
Hoxd4 A G 2: 74,727,313 Y12C probably damaging Het
Hps1 A T 19: 42,760,513 M522K possibly damaging Het
Lrrc8e A T 8: 4,234,611 I279F probably damaging Het
Mettl24 C T 10: 40,683,641 Q96* probably null Het
Muc2 A G 7: 141,693,352 N193S probably damaging Het
Mysm1 A G 4: 94,965,321 L347P probably benign Het
Olfr979 T A 9: 40,000,534 E231V probably damaging Het
Oxtr G T 6: 112,477,230 H24Q probably benign Het
Paxip1 A G 5: 27,775,673 probably benign Het
Pclo C T 5: 14,680,418 probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmeff2 A G 1: 50,979,617 probably benign Het
Virma G T 4: 11,513,177 E344* probably null Het
Zbtb17 G T 4: 141,464,988 G415C probably damaging Het
Other mutations in Tspan31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02926:Tspan31 APN 10 127068909 splice site probably null
R0989:Tspan31 UTSW 10 127068327 missense probably damaging 0.97
R1848:Tspan31 UTSW 10 127069458 missense probably damaging 1.00
R2104:Tspan31 UTSW 10 127068135 missense probably damaging 1.00
R2327:Tspan31 UTSW 10 127068496 missense probably benign 0.02
R6450:Tspan31 UTSW 10 127068358 missense probably damaging 1.00
R7204:Tspan31 UTSW 10 127068118 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACACCTCCTAGGATCTTGAGGG -3'
(R):5'- ATGGAGACTCCTGAACCGAAG -3'

Sequencing Primer
(F):5'- GTCTGAATGTTTAAGGAACCTCTCC -3'
(R):5'- GGGTATGTGAGGAGACTAATGTC -3'
Posted On2015-02-18